ID: 1056073034

View in Genome Browser
Species Human (GRCh38)
Location 9:83008417-83008439
Sequence GGATACGGCTTGGGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056073034_1056073040 -8 Left 1056073034 9:83008417-83008439 CCACCTTTCCCCAAGCCGTATCC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1056073040 9:83008432-83008454 CCGTATCCTTCCCTATGTTCTGG No data
1056073034_1056073047 20 Left 1056073034 9:83008417-83008439 CCACCTTTCCCCAAGCCGTATCC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1056073047 9:83008460-83008482 GCTTTGGTTACTGCCTTACCTGG No data
1056073034_1056073044 4 Left 1056073034 9:83008417-83008439 CCACCTTTCCCCAAGCCGTATCC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1056073044 9:83008444-83008466 CTATGTTCTGGTCCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056073034 Original CRISPR GGATACGGCTTGGGGAAAGG TGG (reversed) Intronic
901766382 1:11502492-11502514 GGATGGGGCTTGAGGAAGGGTGG + Intronic
902774507 1:18666194-18666216 GGGCACAGCCTGGGGAAAGGAGG - Intronic
903820905 1:26101803-26101825 GGATAAGGCTTGGGGCTGGGAGG + Intergenic
904620374 1:31771735-31771757 GGATTCGGCCTGGGAATAGGAGG - Intergenic
907284449 1:53370974-53370996 GGATACGGCAGGGGGAAGCGTGG - Intergenic
909575856 1:77175232-77175254 AGATAAGGCCTGGGGAAATGTGG + Intronic
910518834 1:88094439-88094461 GGATAGTGCATGGGGCAAGGTGG - Intergenic
914348560 1:146820405-146820427 GGAGACCTCTTGGGGAAAGGAGG - Intergenic
914665957 1:149832706-149832728 GGAAAAGGCTTAGGCAAAGGGGG + Intergenic
914669808 1:149861088-149861110 GGAAAAGGCTTAGGCAAAGGGGG - Exonic
917013972 1:170508363-170508385 GTTTACTGCTTGTGGAAAGGAGG + Intergenic
919804370 1:201372428-201372450 GGGTACAGCTTGGGCAAAGATGG - Intronic
920194094 1:204214509-204214531 GGACGCCGCTTGGGGAAAGGAGG - Intergenic
921774270 1:219078952-219078974 GGATAGGGCTAGCGGGAAGGAGG + Intergenic
921806581 1:219462161-219462183 GGATGAGGCAAGGGGAAAGGAGG + Intergenic
921934933 1:220787250-220787272 TGATCCGGCTCGGGGCAAGGGGG + Intronic
923368145 1:233283955-233283977 TGATGCGGGTTGGGGAGAGGTGG + Intronic
924189493 1:241535281-241535303 GGATATGGTTTATGGAAAGGAGG - Intronic
924875002 1:248093191-248093213 GGGTAAGGTTTGGGGAAAGCAGG + Intronic
1064194544 10:13234397-13234419 GGATACCACTGGGGGAGAGGAGG + Intergenic
1066660279 10:37731985-37732007 AGGTAAGGCTTGGGGACAGGTGG + Intergenic
1069886024 10:71624149-71624171 GGAGCCGGCTCAGGGAAAGGAGG - Intronic
1072826653 10:98613558-98613580 GCTTAGGGCTTGGGGAATGGAGG + Intronic
1075841447 10:125508243-125508265 GCACAGGACTTGGGGAAAGGAGG - Intergenic
1078205944 11:9229508-9229530 TGACCCGCCTTGGGGAAAGGGGG - Intronic
1083952461 11:65964587-65964609 GGATAGGGTTTGGGGGAAAGAGG + Intronic
1086501861 11:87462006-87462028 GGATACGGCCTGAGAAAAGTGGG + Intergenic
1086778631 11:90873895-90873917 GCCTAGGGCTGGGGGAAAGGGGG + Intergenic
1088173462 11:107022338-107022360 GGAGAAGGCTGGGGGAAAGGAGG + Intergenic
1089191100 11:116653820-116653842 GAATGGGGCTTGGGGAAGGGAGG + Intergenic
1089622123 11:119728340-119728362 GGTCACGGCTTGGGTAAAGGGGG - Intronic
1089979942 11:122763869-122763891 GGAGAAGGCTAGGGGAGAGGGGG + Intronic
1092280002 12:7091567-7091589 GGGTAAGGCTTGGGGAACAGAGG + Exonic
1092977337 12:13758041-13758063 GGATATGGCTTTGGGGAAGTGGG - Intronic
1093376229 12:18431088-18431110 GGATACGTATTGTGGAGAGGCGG - Intronic
1093639085 12:21504323-21504345 GCATACGGATAGGGAAAAGGGGG + Intronic
1094565110 12:31591571-31591593 GGTGACGGCTGGGGGAAGGGAGG - Intergenic
1096679340 12:53244686-53244708 GGATAGTGAGTGGGGAAAGGAGG - Intergenic
1096689275 12:53309514-53309536 GGAAACATCTTGGGGGAAGGAGG - Intronic
1098158170 12:67621855-67621877 GGATAAGGCTTTGGTAAATGGGG + Intergenic
1101913690 12:108879914-108879936 GGACAGGCCTTGGGGGAAGGAGG - Intronic
1102500266 12:113347181-113347203 GGACAGGGGCTGGGGAAAGGAGG + Intronic
1102949299 12:117018981-117019003 TGAAAAGGATTGGGGAAAGGGGG - Intronic
1103544992 12:121694086-121694108 GGTTACGTCTGGGGGAAAGAAGG + Intergenic
1105437659 13:20391428-20391450 GGGTCGGGGTTGGGGAAAGGAGG + Intergenic
1106061352 13:26295770-26295792 TGTTAATGCTTGGGGAAAGGAGG - Intronic
1106340592 13:28823037-28823059 GGAAACGGGTTGGGGAAGGGAGG + Intronic
1109186816 13:59279515-59279537 GGTTACAGCTTCAGGAAAGGAGG + Intergenic
1109854086 13:68106486-68106508 GGAGATGGCTTGGGGAAAAAAGG + Intergenic
1110984136 13:81941705-81941727 GGCAACAGTTTGGGGAAAGGAGG - Intergenic
1113575250 13:111390609-111390631 GGCCATGGCTTGGGAAAAGGGGG + Intergenic
1115913032 14:38277382-38277404 GGATAGGGGATGGGGAGAGGAGG - Intergenic
1117970153 14:61243529-61243551 AGCTACAGCTTGGGGAACGGAGG + Intronic
1118915351 14:70098338-70098360 AGATAGAGATTGGGGAAAGGGGG - Intronic
1119429186 14:74554952-74554974 GGATGGGGCCTCGGGAAAGGAGG + Intronic
1119586725 14:75842707-75842729 GGGTGGGGGTTGGGGAAAGGAGG + Intronic
1120138568 14:80900881-80900903 GGATACCCCTTGGGAAAAGATGG + Intronic
1120825921 14:88955349-88955371 GGGTATGTGTTGGGGAAAGGAGG - Intergenic
1125907831 15:43409705-43409727 GTATACTGCTTGTTGAAAGGAGG + Exonic
1127128572 15:55837573-55837595 GGAAAAGGCTTGGGGGAAAGGGG + Intronic
1127634053 15:60852301-60852323 GGACATGGGTTGGGGAAAGGTGG - Intronic
1128793025 15:70447146-70447168 GGATGCAGCCTGGGGAGAGGAGG - Intergenic
1133726994 16:8547134-8547156 AAATACGGCTGGGGGAAAAGGGG + Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1136497174 16:30651582-30651604 GGCTGCGGCCTGGGGTAAGGGGG - Exonic
1137033672 16:35548601-35548623 GGAGACGGCCTGGGGAAGGATGG + Intergenic
1139337189 16:66241015-66241037 GGAGACGGGCTGGGGGAAGGGGG + Intergenic
1139985476 16:70895143-70895165 GGAGACCTCTTGGGGAAAGGAGG + Intronic
1143638529 17:8181437-8181459 GGATGAGGCTTGGACAAAGGAGG + Intergenic
1143847349 17:9782616-9782638 GGACAAGTCTTTGGGAAAGGAGG + Intronic
1144465303 17:15492592-15492614 AGGTACGTCTTGGGGAAATGGGG - Intronic
1146521452 17:33528590-33528612 GAATAATGCTTGGGTAAAGGTGG + Intronic
1147192128 17:38744098-38744120 GGCTTCTGCTTGGGGAAAAGTGG - Intronic
1148235661 17:45967345-45967367 GGGGACAGATTGGGGAAAGGGGG + Intronic
1149605532 17:57922320-57922342 GGACAAGTCTTGAGGAAAGGAGG - Intronic
1149651703 17:58280010-58280032 TGATGCTGCTTGGAGAAAGGAGG + Exonic
1151330539 17:73404294-73404316 GGAGGAGGCTTGGGGATAGGAGG + Intronic
1151892964 17:76962028-76962050 GGGCAGGGCTGGGGGAAAGGAGG - Intergenic
1157716537 18:49891739-49891761 AGATCTGGCTTGGGGAATGGGGG - Intronic
1158851307 18:61497810-61497832 GGATTAGGCTTGGGGCAGGGAGG - Intronic
1160877730 19:1304978-1305000 GGAGGCTGCTAGGGGAAAGGAGG + Intergenic
1161026281 19:2038799-2038821 GGAAACGGCTTCGGGCCAGGCGG + Exonic
1164441669 19:28284363-28284385 GGAAAAGGAGTGGGGAAAGGTGG + Intergenic
1164574637 19:29398583-29398605 GCACAGGGCTTGGGGAAAAGGGG - Intergenic
1166705520 19:44905946-44905968 GGGTCGGGCTTGGGGAGAGGAGG + Intronic
1167173389 19:47848823-47848845 GGAAACAGCTGGGGGAAGGGAGG - Intergenic
1168678078 19:58293510-58293532 GAAGAGGGCTTGGGGAAAGCGGG + Intronic
925334012 2:3079961-3079983 TGAGAGGACTTGGGGAAAGGGGG + Intergenic
925817886 2:7771060-7771082 GGATTTGGGTTTGGGAAAGGTGG - Intergenic
926567731 2:14495420-14495442 GGCTAAGGCATGGGGAAAGGAGG + Intergenic
927862977 2:26571494-26571516 GGATTGGGCTTGGGGAAGGCAGG + Intronic
928326402 2:30322896-30322918 GGAAATGGCTTGGGGAAAAAGGG + Intronic
928391814 2:30916415-30916437 GGCTACAGCTTTGGGATAGGAGG - Intronic
929531676 2:42756613-42756635 GGAAACGGCTTTGGGGAGGGAGG + Exonic
929689821 2:44064905-44064927 GGATAAGGCTTGAGGGAAAGAGG - Intergenic
934607613 2:95709056-95709078 GATTATGGCTTGGGTAAAGGTGG - Intergenic
935701864 2:105819948-105819970 TGAAAGGGCATGGGGAAAGGTGG - Intronic
940726157 2:157339084-157339106 GGAGAAGACTTGGGGGAAGGGGG - Intergenic
942453034 2:176120507-176120529 GGGTAGGGCTGAGGGAAAGGGGG - Intergenic
945262626 2:207858959-207858981 GTCTAGGGCTTGGGGGAAGGAGG - Intronic
946445987 2:219740262-219740284 GGATTCCGCTGGGGGAAGGGTGG - Intergenic
946862156 2:224010485-224010507 GGAAAAGGCTAGGGGGAAGGAGG + Intronic
1168837585 20:888127-888149 GGATTAGGATTGGGGCAAGGAGG - Intronic
1168848218 20:959533-959555 TGATCCGGCTTGGGAAAAAGGGG + Exonic
1170466821 20:16629774-16629796 GAATAGAGCTTGGAGAAAGGGGG + Intergenic
1172884734 20:38223444-38223466 GGGGACGGCCTGGGGAAAAGGGG - Intronic
1173685639 20:44921580-44921602 GACCACGGCCTGGGGAAAGGAGG - Exonic
1174103206 20:48143024-48143046 GGCTACTGCTTGGGGAAGGAGGG + Intergenic
1175926225 20:62472963-62472985 GGATGAGGCTTGAGGGAAGGTGG - Intronic
1177323002 21:19546137-19546159 GGATATGGTTGGGGGAAAAGAGG + Intergenic
1179156269 21:38853706-38853728 TGGTAGGGCTTGGGGAAAGCAGG - Intergenic
1179328460 21:40374584-40374606 GTGAAAGGCTTGGGGAAAGGAGG + Intronic
1185313542 22:50169630-50169652 GGATGGGGCGTGGGGGAAGGAGG + Intergenic
949767733 3:7545681-7545703 GGAGATGACTTGGGGCAAGGAGG + Intronic
950443957 3:13025483-13025505 GGACCCTGCTTGGGGAAATGAGG + Intronic
954618546 3:51983118-51983140 GGATAGGGCGGGAGGAAAGGGGG - Intronic
955933733 3:64082681-64082703 TGATAGTGCTTGGGAAAAGGAGG - Intergenic
956340037 3:68212168-68212190 GGAAGCTGCTTGGGGAGAGGAGG + Intronic
956514673 3:70033726-70033748 GGAGACTGCTTGGAGAGAGGTGG + Intergenic
956659436 3:71583521-71583543 GGAGGCGGCTTGGGAAAAAGTGG + Intronic
959656571 3:108812685-108812707 GGGGAAGGCTTGGGGAAATGAGG - Intergenic
959990088 3:112621757-112621779 GGGTGTGACTTGGGGAAAGGTGG - Intronic
960630823 3:119728823-119728845 GGATAGGGCAGGGGGAAAAGAGG - Intronic
962891512 3:139677053-139677075 GAATGTGGCTTGAGGAAAGGAGG - Intronic
966710345 3:182966238-182966260 GGATATGGCGTGGGAAGAGGGGG + Intronic
968504231 4:964569-964591 GGGCAGGGCTGGGGGAAAGGGGG - Intronic
968620899 4:1603073-1603095 GCACTGGGCTTGGGGAAAGGTGG - Intergenic
968859412 4:3154423-3154445 GGAAACAGCGTGGGGAAGGGAGG + Intronic
976676268 4:87707246-87707268 GGCCACAGCTTGGGGAAAGGGGG + Intergenic
981973852 4:150699223-150699245 GGAGACGACCTGGGGAAAGAGGG + Intronic
985654097 5:1121096-1121118 GGAGGCAGCTTGGGGAACGGTGG - Intergenic
986605971 5:9523259-9523281 GGATAAGGCTCTGGAAAAGGAGG - Intronic
986649745 5:9951209-9951231 GGATATTGCATGGGGAAAAGTGG - Intergenic
993333984 5:86634146-86634168 GGTTAGGACTTGGGCAAAGGGGG + Intergenic
996900357 5:128537299-128537321 GGCTCCGGCTTGGGGGAGGGGGG - Intronic
997009863 5:129863101-129863123 GGATAGGGCCTGGAGAAGGGAGG + Intergenic
1001965565 5:175907657-175907679 GGAGCAGGCTTGGGCAAAGGGGG - Intergenic
1002128690 5:177065794-177065816 GGATAGGGAGTGGGGGAAGGAGG - Exonic
1005464961 6:26103969-26103991 GGAAAAGGCTTGGGGAAGGGTGG + Exonic
1005480029 6:26246934-26246956 GGAAAAGGCCTTGGGAAAGGCGG - Exonic
1005570344 6:27139330-27139352 GGTAAGGGCCTGGGGAAAGGGGG + Exonic
1005875761 6:30008572-30008594 GGAGAGGGCTCTGGGAAAGGAGG - Intergenic
1006052449 6:31355214-31355236 GAAGACGGCTCTGGGAAAGGAGG + Exonic
1006254466 6:32819285-32819307 GCATAAGGCTTGGGGGAAGAAGG + Intronic
1006254791 6:32822109-32822131 TGATACGACTTTGGGATAGGTGG + Intronic
1006256211 6:32834727-32834749 GGATGCAGCATAGGGAAAGGAGG - Intronic
1007167925 6:39841392-39841414 GGGAACTCCTTGGGGAAAGGTGG + Intronic
1007410323 6:41657661-41657683 GGCTACGGCCTGGGGGAAAGCGG - Intergenic
1007581346 6:42962074-42962096 GGAGAGGGCCTGGGGAGAGGAGG + Intronic
1007690754 6:43699633-43699655 GGAAAGGGCTTGGGGACAGAGGG + Intergenic
1007849254 6:44788335-44788357 GAATGGGGCTTGTGGAAAGGAGG - Intergenic
1009320915 6:62286875-62286897 AGATAGGGTCTGGGGAAAGGAGG - Intergenic
1013092612 6:106913953-106913975 GGAAACAGCTAGGTGAAAGGAGG - Intergenic
1013636812 6:112036982-112037004 GGATAGGGCATGGGGCAAGAGGG - Intergenic
1017618121 6:156266631-156266653 GGATTCTGCTTTGGGAAAGAAGG - Intergenic
1022383609 7:29883215-29883237 GCATAAGTCTTTGGGAAAGGAGG + Intronic
1022793337 7:33711573-33711595 GTATACGGGTTGGAGAAAGGGGG - Intergenic
1024121728 7:46248819-46248841 GGATATCACCTGGGGAAAGGTGG - Intergenic
1024261275 7:47576010-47576032 GGACAGGGCTGGAGGAAAGGGGG - Intronic
1026670265 7:72384099-72384121 GGATATGACTTGGAGGAAGGAGG + Intronic
1026678456 7:72447548-72447570 GGACACTGCCTGGGGAAAGTGGG + Intergenic
1026760571 7:73122946-73122968 GGCCAGAGCTTGGGGAAAGGGGG + Intergenic
1028646804 7:93107587-93107609 GGAGACAGCCTGGGGAATGGTGG + Intronic
1029636547 7:101788343-101788365 GGATTGGGCTTGGGGAATGAGGG - Intergenic
1031270366 7:119641804-119641826 GGATATGTATTGGGGTAAGGTGG - Intergenic
1031512260 7:122665264-122665286 GGAAAAGGCTTGGGGTCAGGTGG - Intronic
1033378839 7:140792429-140792451 GGAGAAGGCTTGGGGAATGGTGG - Intronic
1039658231 8:39433528-39433550 TGAGCCGCCTTGGGGAAAGGTGG + Intergenic
1044391749 8:91660633-91660655 GGATGTGGCTTTGGGCAAGGTGG - Intergenic
1045636741 8:104199921-104199943 GGGTCCTACTTGGGGAAAGGAGG + Intronic
1046046717 8:108973608-108973630 GGATAAGGTTTGGGGGAAGGAGG - Intergenic
1048270197 8:133022202-133022224 GGATGGGTCTTGGGGAAAAGGGG - Intronic
1050132520 9:2427435-2427457 GAAGACAGCTTGGGGAAGGGAGG + Intergenic
1051198771 9:14593952-14593974 GGAGACAGCTTGGGGAAACAGGG + Intergenic
1052663605 9:31467538-31467560 AGATAAGGCTTGGGGACATGTGG - Intergenic
1053218660 9:36293512-36293534 GGATGGGACTTAGGGAAAGGAGG + Intronic
1055661353 9:78507032-78507054 AGAGACAGGTTGGGGAAAGGTGG - Intergenic
1056073034 9:83008417-83008439 GGATACGGCTTGGGGAAAGGTGG - Intronic
1057401702 9:94728936-94728958 GGATAGGGATTGAGGAAAGTTGG + Intronic
1058869381 9:109189294-109189316 GGAAAAGGTTTGGGAAAAGGAGG + Intronic
1059765619 9:117381215-117381237 GGTTACAGCATGGGGAAAAGAGG + Intronic
1060054019 9:120397961-120397983 GGATCCAGCGTGGGGAAAGAGGG - Intronic
1061364988 9:130168006-130168028 GGGAACTGCTTGGGGAAGGGTGG - Intergenic
1185931800 X:4211778-4211800 GAATACGGCTTGTTGAGAGGAGG + Intergenic
1186928584 X:14361800-14361822 GGCTCCAGCTTGGGGAAGGGGGG - Intergenic
1187449903 X:19387094-19387116 GGATAAGCCTGGTGGAAAGGTGG + Intronic
1188702032 X:33277118-33277140 TGATATGGATTGGGGGAAGGTGG - Intronic
1190332943 X:49247162-49247184 GGAAACTGCCTGAGGAAAGGGGG - Intronic
1191666423 X:63707251-63707273 GGAAAGGGCTTGGGCCAAGGTGG + Intronic
1191692591 X:63956321-63956343 GTATACTGCTTGGGTAATGGGGG + Intergenic
1194816940 X:98454142-98454164 GGAGAAGGGTAGGGGAAAGGTGG - Intergenic
1195089597 X:101445882-101445904 GGAATCTGCATGGGGAAAGGTGG - Intronic
1200866738 Y:8051943-8051965 GGGAAGGGCTTGGGAAAAGGAGG - Intergenic