ID: 1056078141

View in Genome Browser
Species Human (GRCh38)
Location 9:83062509-83062531
Sequence GCGGCGCTGGCCACCTCGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078141_1056078149 25 Left 1056078141 9:83062509-83062531 CCGCACGAGGTGGCCAGCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078141 Original CRISPR GCGGCGCTGGCCACCTCGTG CGG (reversed) Exonic