ID: 1056078142 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:83062522-83062544 |
Sequence | CGAGGACGCGGCGGCGGCGC TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1333 | |||
Summary | {0: 1, 1: 1, 2: 21, 3: 169, 4: 1141} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056078142_1056078151 | 29 | Left | 1056078142 | 9:83062522-83062544 | CCAGCGCCGCCGCCGCGTCCTCG | 0: 1 1: 1 2: 21 3: 169 4: 1141 |
||
Right | 1056078151 | 9:83062574-83062596 | CTCCGGCCCCGCCTCAGACACGG | 0: 1 1: 0 2: 0 3: 16 4: 169 |
||||
1056078142_1056078149 | 12 | Left | 1056078142 | 9:83062522-83062544 | CCAGCGCCGCCGCCGCGTCCTCG | 0: 1 1: 1 2: 21 3: 169 4: 1141 |
||
Right | 1056078149 | 9:83062557-83062579 | TCCTCGCTGTCGTGTGTCTCCGG | 0: 1 1: 0 2: 0 3: 4 4: 71 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056078142 | Original CRISPR | CGAGGACGCGGCGGCGGCGC TGG (reversed) | Exonic | ||