ID: 1056078143 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:83062528-83062550 |
Sequence | AGGCGACGAGGACGCGGCGG CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 258 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 22, 4: 232} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056078143_1056078153 | 26 | Left | 1056078143 | 9:83062528-83062550 | CCGCCGCCGCGTCCTCGTCGCCT | 0: 1 1: 0 2: 3 3: 22 4: 232 |
||
Right | 1056078153 | 9:83062577-83062599 | CGGCCCCGCCTCAGACACGGCGG | 0: 1 1: 0 2: 0 3: 14 4: 221 |
||||
1056078143_1056078151 | 23 | Left | 1056078143 | 9:83062528-83062550 | CCGCCGCCGCGTCCTCGTCGCCT | 0: 1 1: 0 2: 3 3: 22 4: 232 |
||
Right | 1056078151 | 9:83062574-83062596 | CTCCGGCCCCGCCTCAGACACGG | 0: 1 1: 0 2: 0 3: 16 4: 169 |
||||
1056078143_1056078149 | 6 | Left | 1056078143 | 9:83062528-83062550 | CCGCCGCCGCGTCCTCGTCGCCT | 0: 1 1: 0 2: 3 3: 22 4: 232 |
||
Right | 1056078149 | 9:83062557-83062579 | TCCTCGCTGTCGTGTGTCTCCGG | 0: 1 1: 0 2: 0 3: 4 4: 71 |
||||
1056078143_1056078154 | 27 | Left | 1056078143 | 9:83062528-83062550 | CCGCCGCCGCGTCCTCGTCGCCT | 0: 1 1: 0 2: 3 3: 22 4: 232 |
||
Right | 1056078154 | 9:83062578-83062600 | GGCCCCGCCTCAGACACGGCGGG | 0: 1 1: 0 2: 0 3: 5 4: 136 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056078143 | Original CRISPR | AGGCGACGAGGACGCGGCGG CGG (reversed) | Exonic | ||