ID: 1056078143

View in Genome Browser
Species Human (GRCh38)
Location 9:83062528-83062550
Sequence AGGCGACGAGGACGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078143_1056078153 26 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078143_1056078151 23 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG 0: 1
1: 0
2: 0
3: 16
4: 169
1056078143_1056078149 6 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078143_1056078154 27 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078154 9:83062578-83062600 GGCCCCGCCTCAGACACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078143 Original CRISPR AGGCGACGAGGACGCGGCGG CGG (reversed) Exonic