ID: 1056078144

View in Genome Browser
Species Human (GRCh38)
Location 9:83062531-83062553
Sequence CGAAGGCGACGAGGACGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078144_1056078158 29 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078158 9:83062583-83062605 CGCCTCAGACACGGCGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
1056078144_1056078154 24 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078154 9:83062578-83062600 GGCCCCGCCTCAGACACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 136
1056078144_1056078153 23 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078144_1056078151 20 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG 0: 1
1: 0
2: 0
3: 16
4: 169
1056078144_1056078149 3 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078144_1056078159 30 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078159 9:83062584-83062606 GCCTCAGACACGGCGGGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078144 Original CRISPR CGAAGGCGACGAGGACGCGG CGG (reversed) Exonic