ID: 1056078145

View in Genome Browser
Species Human (GRCh38)
Location 9:83062534-83062556
Sequence GGACGAAGGCGACGAGGACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078145_1056078159 27 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078159 9:83062584-83062606 GCCTCAGACACGGCGGGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1056078145_1056078154 21 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078154 9:83062578-83062600 GGCCCCGCCTCAGACACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 136
1056078145_1056078149 0 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078145_1056078151 17 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG 0: 1
1: 0
2: 0
3: 16
4: 169
1056078145_1056078158 26 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078158 9:83062583-83062605 CGCCTCAGACACGGCGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
1056078145_1056078153 20 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078145 Original CRISPR GGACGAAGGCGACGAGGACG CGG (reversed) Exonic