ID: 1056078146

View in Genome Browser
Species Human (GRCh38)
Location 9:83062540-83062562
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 381}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078146_1056078154 15 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078154 9:83062578-83062600 GGCCCCGCCTCAGACACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 136
1056078146_1056078151 11 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG 0: 1
1: 0
2: 0
3: 16
4: 169
1056078146_1056078161 30 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078146_1056078158 20 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078158 9:83062583-83062605 CGCCTCAGACACGGCGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
1056078146_1056078159 21 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078159 9:83062584-83062606 GCCTCAGACACGGCGGGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1056078146_1056078149 -6 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078146_1056078153 14 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078146 Original CRISPR CGAGGAGGACGAAGGCGACG AGG (reversed) Exonic