ID: 1056078149

View in Genome Browser
Species Human (GRCh38)
Location 9:83062557-83062579
Sequence TCCTCGCTGTCGTGTGTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078145_1056078149 0 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078143_1056078149 6 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078142_1056078149 12 Left 1056078142 9:83062522-83062544 CCAGCGCCGCCGCCGCGTCCTCG 0: 1
1: 1
2: 21
3: 169
4: 1141
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078144_1056078149 3 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078140_1056078149 30 Left 1056078140 9:83062504-83062526 CCGGGCCGCACGAGGTGGCCAGC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078146_1056078149 -6 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1056078141_1056078149 25 Left 1056078141 9:83062509-83062531 CCGCACGAGGTGGCCAGCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1056078149 9:83062557-83062579 TCCTCGCTGTCGTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078149 Original CRISPR TCCTCGCTGTCGTGTGTCTC CGG Exonic