ID: 1056078150

View in Genome Browser
Species Human (GRCh38)
Location 9:83062558-83062580
Sequence GCCGGAGACACACGACAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078150_1056078154 -3 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078154 9:83062578-83062600 GGCCCCGCCTCAGACACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 136
1056078150_1056078162 25 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078162 9:83062606-83062628 GATCCAGAGGACCCCAGTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 161
1056078150_1056078158 2 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078158 9:83062583-83062605 CGCCTCAGACACGGCGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
1056078150_1056078153 -4 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078150_1056078151 -7 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG 0: 1
1: 0
2: 0
3: 16
4: 169
1056078150_1056078159 3 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078159 9:83062584-83062606 GCCTCAGACACGGCGGGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1056078150_1056078161 12 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078150 Original CRISPR GCCGGAGACACACGACAGCG AGG (reversed) Exonic