ID: 1056078152

View in Genome Browser
Species Human (GRCh38)
Location 9:83062576-83062598
Sequence CGCCGTGTCTGAGGCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078152_1056078167 22 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078167 9:83062621-83062643 AGTCCCGGCGCCGCCCCCCGCGG 0: 1
1: 0
2: 5
3: 15
4: 404
1056078152_1056078161 -6 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078152_1056078169 25 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078169 9:83062624-83062646 CCCGGCGCCGCCCCCCGCGGAGG 0: 1
1: 0
2: 7
3: 59
4: 399
1056078152_1056078162 7 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078162 9:83062606-83062628 GATCCAGAGGACCCCAGTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 161
1056078152_1056078171 26 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078171 9:83062625-83062647 CCGGCGCCGCCCCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 41
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078152 Original CRISPR CGCCGTGTCTGAGGCGGGGC CGG (reversed) Exonic