ID: 1056078153

View in Genome Browser
Species Human (GRCh38)
Location 9:83062577-83062599
Sequence CGGCCCCGCCTCAGACACGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078147_1056078153 6 Left 1056078147 9:83062548-83062570 CCTTCGTCCTCCTCGCTGTCGTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078145_1056078153 20 Left 1056078145 9:83062534-83062556 CCGCGTCCTCGTCGCCTTCGTCC 0: 1
1: 0
2: 4
3: 34
4: 278
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078148_1056078153 -1 Left 1056078148 9:83062555-83062577 CCTCCTCGCTGTCGTGTGTCTCC 0: 1
1: 0
2: 2
3: 7
4: 99
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078143_1056078153 26 Left 1056078143 9:83062528-83062550 CCGCCGCCGCGTCCTCGTCGCCT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078150_1056078153 -4 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078144_1056078153 23 Left 1056078144 9:83062531-83062553 CCGCCGCGTCCTCGTCGCCTTCG 0: 1
1: 0
2: 3
3: 10
4: 129
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221
1056078146_1056078153 14 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078153 9:83062577-83062599 CGGCCCCGCCTCAGACACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078153 Original CRISPR CGGCCCCGCCTCAGACACGG CGG Exonic