ID: 1056078161

View in Genome Browser
Species Human (GRCh38)
Location 9:83062593-83062615
Sequence ACGGCGGGCGCGGGATCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056078148_1056078161 15 Left 1056078148 9:83062555-83062577 CCTCCTCGCTGTCGTGTGTCTCC 0: 1
1: 0
2: 2
3: 7
4: 99
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078147_1056078161 22 Left 1056078147 9:83062548-83062570 CCTTCGTCCTCCTCGCTGTCGTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078150_1056078161 12 Left 1056078150 9:83062558-83062580 CCTCGCTGTCGTGTGTCTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078155_1056078161 -10 Left 1056078155 9:83062580-83062602 CCCCGCCTCAGACACGGCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078152_1056078161 -6 Left 1056078152 9:83062576-83062598 CCGGCCCCGCCTCAGACACGGCG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1056078146_1056078161 30 Left 1056078146 9:83062540-83062562 CCTCGTCGCCTTCGTCCTCCTCG 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1056078161 9:83062593-83062615 ACGGCGGGCGCGGGATCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056078161 Original CRISPR ACGGCGGGCGCGGGATCCAG AGG Exonic