ID: 1056083284

View in Genome Browser
Species Human (GRCh38)
Location 9:83119570-83119592
Sequence GAAGCAAGCCATGGAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056083281_1056083284 -9 Left 1056083281 9:83119556-83119578 CCACTGGCAATTTTGAAGCAAGC No data
Right 1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG No data
1056083278_1056083284 8 Left 1056083278 9:83119539-83119561 CCTCCACATCAAGTACACCACTG No data
Right 1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG No data
1056083276_1056083284 10 Left 1056083276 9:83119537-83119559 CCCCTCCACATCAAGTACACCAC No data
Right 1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG No data
1056083280_1056083284 5 Left 1056083280 9:83119542-83119564 CCACATCAAGTACACCACTGGCA No data
Right 1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG No data
1056083277_1056083284 9 Left 1056083277 9:83119538-83119560 CCCTCCACATCAAGTACACCACT No data
Right 1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056083284 Original CRISPR GAAGCAAGCCATGGAGGAGT TGG Intergenic
No off target data available for this crispr