ID: 1056084948

View in Genome Browser
Species Human (GRCh38)
Location 9:83138459-83138481
Sequence TGCAAATTAGGGCATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056084948_1056084951 -5 Left 1056084948 9:83138459-83138481 CCATAAAAATGCCCTAATTTGCA No data
Right 1056084951 9:83138477-83138499 TTGCAAACAAAGAATTATAATGG No data
1056084948_1056084952 9 Left 1056084948 9:83138459-83138481 CCATAAAAATGCCCTAATTTGCA No data
Right 1056084952 9:83138491-83138513 TTATAATGGAATCTATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056084948 Original CRISPR TGCAAATTAGGGCATTTTTA TGG (reversed) Intergenic
No off target data available for this crispr