ID: 1056084951

View in Genome Browser
Species Human (GRCh38)
Location 9:83138477-83138499
Sequence TTGCAAACAAAGAATTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056084948_1056084951 -5 Left 1056084948 9:83138459-83138481 CCATAAAAATGCCCTAATTTGCA No data
Right 1056084951 9:83138477-83138499 TTGCAAACAAAGAATTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056084951 Original CRISPR TTGCAAACAAAGAATTATAA TGG Intergenic
No off target data available for this crispr