ID: 1056084952

View in Genome Browser
Species Human (GRCh38)
Location 9:83138491-83138513
Sequence TTATAATGGAATCTATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056084950_1056084952 -3 Left 1056084950 9:83138471-83138493 CCTAATTTGCAAACAAAGAATTA No data
Right 1056084952 9:83138491-83138513 TTATAATGGAATCTATTTTGAGG No data
1056084948_1056084952 9 Left 1056084948 9:83138459-83138481 CCATAAAAATGCCCTAATTTGCA No data
Right 1056084952 9:83138491-83138513 TTATAATGGAATCTATTTTGAGG No data
1056084949_1056084952 -2 Left 1056084949 9:83138470-83138492 CCCTAATTTGCAAACAAAGAATT No data
Right 1056084952 9:83138491-83138513 TTATAATGGAATCTATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056084952 Original CRISPR TTATAATGGAATCTATTTTG AGG Intergenic
No off target data available for this crispr