ID: 1056089006

View in Genome Browser
Species Human (GRCh38)
Location 9:83186092-83186114
Sequence AAAGATCTGCTGAAACTAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056089003_1056089006 -1 Left 1056089003 9:83186070-83186092 CCTGAGCAACCATTTGCATAAGA No data
Right 1056089006 9:83186092-83186114 AAAGATCTGCTGAAACTAACGGG No data
1056089004_1056089006 -10 Left 1056089004 9:83186079-83186101 CCATTTGCATAAGAAAGATCTGC No data
Right 1056089006 9:83186092-83186114 AAAGATCTGCTGAAACTAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056089006 Original CRISPR AAAGATCTGCTGAAACTAAC GGG Intergenic
No off target data available for this crispr