ID: 1056091065

View in Genome Browser
Species Human (GRCh38)
Location 9:83206814-83206836
Sequence AACAGCTTCTGGAAGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056091065_1056091077 24 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091077 9:83206861-83206883 CCAGCCTTCTCCTTGGGGATGGG No data
1056091065_1056091071 17 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091071 9:83206854-83206876 CTTTGGCCCAGCCTTCTCCTTGG No data
1056091065_1056091067 0 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091067 9:83206837-83206859 CACCTCCAGAGCTGCCTCTTTGG No data
1056091065_1056091073 19 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091073 9:83206856-83206878 TTGGCCCAGCCTTCTCCTTGGGG No data
1056091065_1056091075 23 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091075 9:83206860-83206882 CCCAGCCTTCTCCTTGGGGATGG No data
1056091065_1056091072 18 Left 1056091065 9:83206814-83206836 CCTTCAGGCTTCCAGAAGCTGTT No data
Right 1056091072 9:83206855-83206877 TTTGGCCCAGCCTTCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056091065 Original CRISPR AACAGCTTCTGGAAGCCTGA AGG (reversed) Intergenic
No off target data available for this crispr