ID: 1056094903

View in Genome Browser
Species Human (GRCh38)
Location 9:83242951-83242973
Sequence TTATCTACTGGGAACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056094903_1056094910 -6 Left 1056094903 9:83242951-83242973 CCACCCCAGTTCCCAGTAGATAA No data
Right 1056094910 9:83242968-83242990 AGATAATAGATACAATGGCCAGG No data
1056094903_1056094915 27 Left 1056094903 9:83242951-83242973 CCACCCCAGTTCCCAGTAGATAA No data
Right 1056094915 9:83243001-83243023 AAGCAGCTTTATTAATGGATTGG 0: 1
1: 0
2: 0
3: 16
4: 175
1056094903_1056094912 0 Left 1056094903 9:83242951-83242973 CCACCCCAGTTCCCAGTAGATAA No data
Right 1056094912 9:83242974-83242996 TAGATACAATGGCCAGGAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 224
1056094903_1056094914 22 Left 1056094903 9:83242951-83242973 CCACCCCAGTTCCCAGTAGATAA No data
Right 1056094914 9:83242996-83243018 GTTAAAAGCAGCTTTATTAATGG 0: 1
1: 0
2: 3
3: 27
4: 306
1056094903_1056094911 -1 Left 1056094903 9:83242951-83242973 CCACCCCAGTTCCCAGTAGATAA No data
Right 1056094911 9:83242973-83242995 ATAGATACAATGGCCAGGAGAGG 0: 1
1: 0
2: 0
3: 28
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056094903 Original CRISPR TTATCTACTGGGAACTGGGG TGG (reversed) Intergenic
No off target data available for this crispr