ID: 1056100877

View in Genome Browser
Species Human (GRCh38)
Location 9:83299658-83299680
Sequence AATGCACAGTGAGTTCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056100877_1056100885 20 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data
1056100877_1056100879 -10 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100879 9:83299671-83299693 ACTGTGCATTGCCCAAGTGAGGG No data
1056100877_1056100881 -2 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100881 9:83299679-83299701 TTGCCCAAGTGAGGGAACAAGGG No data
1056100877_1056100884 15 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100884 9:83299696-83299718 CAAGGGTCCCGCATCACCACAGG No data
1056100877_1056100880 -3 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100880 9:83299678-83299700 ATTGCCCAAGTGAGGGAACAAGG No data
1056100877_1056100888 27 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100888 9:83299708-83299730 ATCACCACAGGAATGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056100877 Original CRISPR AATGCACAGTGAGTTCTTCG TGG (reversed) Intronic
902930989 1:19731337-19731359 AATGCTCAGCGAGTACTTCTGGG + Intronic
903119462 1:21205620-21205642 AATGCAGAGTGCATTCTTCTTGG + Intergenic
907099464 1:51815386-51815408 AATGTCAAGTGAGTTCTTTGAGG + Intronic
909302837 1:74036005-74036027 ACTGGACTGTGAGTTCTTAGAGG + Intronic
909922735 1:81401755-81401777 AATGCACAGTGAGTTCGAACAGG - Intronic
910515751 1:88058100-88058122 AATGCAAAATGAGTTCCTCCTGG - Intergenic
917001752 1:170368200-170368222 AATGGTCAGTGAGACCTTCGGGG - Intergenic
917155875 1:171998388-171998410 AATGCTCACTGAGTGCTTTGTGG - Intronic
917942480 1:179936172-179936194 AAAGTACAGTGAGTTCCTTGAGG + Intergenic
919181302 1:194085660-194085682 TCTGCACTGTGAGTTCTTTGAGG + Intergenic
919907834 1:202090219-202090241 ACTGCACAGTGAGGACTTCAGGG - Intergenic
920852884 1:209640596-209640618 AATGCACAGTGAGTGGTGGGAGG - Intronic
921684500 1:218074524-218074546 AATGAACAGTGAGTTTTCCAAGG - Intergenic
1062897370 10:1114509-1114531 AATGCACATTGCGTTTTTAGAGG + Intronic
1062925250 10:1311448-1311470 AATGCTTAGTGGGTTCTTCCGGG + Intronic
1063741080 10:8820708-8820730 ACTGCACAGTAAGTTCCTCAAGG - Intergenic
1063871851 10:10425721-10425743 AATGAACAGTTAGTTCTTCCAGG - Intergenic
1069622249 10:69845120-69845142 AAAGCACAGTGAAGTCTTGGAGG - Intronic
1071159661 10:82730892-82730914 AATGCAAAGTGTGTTCTGGGTGG - Intronic
1071233715 10:83619579-83619601 AGTGCACACTGATTTCTTCCTGG + Intergenic
1074734466 10:116414355-116414377 ATTACACTGTGAGTTCTTCAAGG - Intergenic
1075736260 10:124666413-124666435 CATCCACAGGGAGCTCTTCGGGG - Intronic
1077578378 11:3401593-3401615 AATGCACAGAGAGATGTTCTAGG - Intergenic
1082089984 11:48081296-48081318 AATGAACAGTGTCTTCTCCGTGG + Intronic
1088078842 11:105884799-105884821 AATGGACAATGAGTTCTTTATGG + Intronic
1101654361 12:106706996-106707018 AATGCACACTAAGTTTTTAGGGG + Intronic
1105356064 13:19660884-19660906 AATGAACAGTGAATTTTTGGGGG - Intronic
1107694844 13:42990276-42990298 AGTGTACAGTGAGCTCTTCAGGG + Intronic
1109103686 13:58221104-58221126 AATGAAGAGTGAGTGCTTCAGGG - Intergenic
1112768515 13:102772474-102772496 GATGCACAGTGTGTTCTTCACGG + Intronic
1113230233 13:108205784-108205806 AATACACTGTGAGTTCTTTGAGG + Intergenic
1113238635 13:108312132-108312154 AATGCACAGCAAGTTCTTGCAGG - Intergenic
1115095370 14:29629758-29629780 AATGAACAGAGAATTCTTCCTGG + Intronic
1116631861 14:47345953-47345975 AATGCAGAGAGATTTCTTCAAGG + Intronic
1117671252 14:58108379-58108401 ATTGAATAGTGAGTTCTTTGGGG - Intronic
1122156922 14:99755514-99755536 AGTGCACAGTGGGTGCTTAGTGG + Intronic
1126391089 15:48153381-48153403 AATGAACTGTGAGTTCTTCCAGG + Intronic
1126812076 15:52417026-52417048 AAGGCACAGTGAGTTTTTGCTGG + Intronic
1127536131 15:59891477-59891499 AATGCCCAGTGAGTTCCCCAAGG - Intergenic
1132492433 16:240107-240129 AATGCCCAGCGTGTTCTTGGTGG + Intronic
1133198845 16:4190048-4190070 AAAGAACAGTGAGTTCTGCAAGG - Exonic
1134673989 16:16076498-16076520 AAGGCAAAGTGAGTTGTTCAAGG - Intronic
1135817294 16:25646598-25646620 AATGCACAGTCAGGTCTCTGGGG + Intergenic
1136656885 16:31714669-31714691 AAGGCCCAGTTAGTTCTTCCTGG + Intronic
1138722137 16:59094711-59094733 AATAGACAGTGAATTCTTGGAGG + Intergenic
1139088047 16:63612985-63613007 GATGCAAAGTCAGTTCTTTGGGG + Intergenic
1139290750 16:65855813-65855835 AATCAGCAGTGAGTTCTTGGAGG - Intergenic
1145285019 17:21498946-21498968 GATGCACAGTGAGTGGTTTGTGG + Intergenic
1151479119 17:74360045-74360067 ACTGCACAGTGAGCTGTTCCTGG - Exonic
1153460005 18:5322762-5322784 ATTGGACAGTGAGGTCTTTGAGG + Intergenic
1154969643 18:21394419-21394441 ACTGCAATGTGAGTTCTTGGAGG + Intronic
1155527109 18:26728482-26728504 ATTACACAGTGAGTTCCTCATGG + Intergenic
1156544900 18:37954969-37954991 ACTGGATAGTGAGTTCCTCGTGG + Intergenic
1158377738 18:56890330-56890352 AAAGCACAGGGAGTACTTGGGGG - Intronic
1159344140 18:67176632-67176654 AATGCACAGGGAGCTCCTGGTGG + Intergenic
1160496171 18:79377120-79377142 AATGCACAGTGATGTTTCCGTGG + Intronic
1164183011 19:22836139-22836161 AAGGCACCGTTAGTTCTTCCTGG + Intergenic
1164225945 19:23246023-23246045 AAGGCCCAGTTAGTTCTTCCTGG - Intronic
1166285882 19:41828015-41828037 AAAGCACAGAGAGTGCTTGGAGG - Intergenic
1168510434 19:56969191-56969213 AATGCAAAGTGTATTCTTTGAGG - Intergenic
924973024 2:148126-148148 AATGCACAGTGAGATTTGGGTGG + Intergenic
926801343 2:16663640-16663662 AATGCAAACTGAATTCTTCTTGG + Intronic
930405961 2:50956049-50956071 AATGTCCAGTTAGTTCTTCCAGG + Intronic
931259314 2:60603456-60603478 AATGCGGAGTGAGTGCCTCGTGG + Intergenic
932508831 2:72264626-72264648 AATTCAAAGTGAGATCTTGGTGG - Intronic
934570953 2:95373049-95373071 ACTGCACAGTGAGCTCTTCAGGG - Intronic
940435929 2:153654451-153654473 AATGTACACTGAGTTATTTGTGG + Intergenic
946012688 2:216579065-216579087 GATGCACAGTGAGTTTTTCCCGG - Intronic
948900075 2:240951962-240951984 ACTCAACAGTGAATTCTTCGGGG - Intronic
1173430347 20:42982304-42982326 CATGCACAGTGAGCTCTGTGAGG - Intronic
1174959003 20:55134171-55134193 AATGCAGATTGAGATCTTTGAGG - Intergenic
1176421559 21:6520204-6520226 TGTGCACAGTGTGTTCTTCCAGG + Intergenic
1177021746 21:15869011-15869033 AAGGCACAGGGAGTTGTTTGAGG + Intronic
1178227804 21:30743901-30743923 ATTCCACAGTGAGTACTTCCTGG + Intergenic
1179303324 21:40132536-40132558 AATGCACAGGTAGTCCTTCCAGG - Intronic
1179417022 21:41207198-41207220 AATGCATAATGGGTTCTTAGGGG + Intronic
1179484847 21:41703649-41703671 AATGGGGAGTGAGTGCTTCGTGG + Intergenic
1179697049 21:43128520-43128542 TGTGCACAGTGTGTTCTTCCAGG + Intergenic
949299436 3:2566802-2566824 CACGCACACTGAGTTCTTCCTGG - Intronic
951579235 3:24144287-24144309 AATGTACAGTGAGTACCTTGAGG - Intronic
954981752 3:54752214-54752236 AATGCAGAGTGTGCTCTTCTTGG - Intronic
955264503 3:57428341-57428363 AATGTACATTGAGTTTTTAGAGG + Intronic
955447011 3:59023268-59023290 CATGCACAGAGAATTCTTCTAGG + Intronic
957397876 3:79666696-79666718 AATGGACAGATAGTTCCTCGTGG - Intronic
959806612 3:110562192-110562214 GATCCACAGTGAGTACTTCCTGG + Intergenic
962295907 3:134186560-134186582 AAAGCACAGTGAGTCCTTATGGG - Intronic
966852113 3:184170722-184170744 AAACCCCAGTGAGTTCTTTGTGG + Exonic
968975186 4:3818519-3818541 AATTCACAGTGAGATCTGGGTGG - Intergenic
971105202 4:23517201-23517223 TAAGTACAGTGAGTTCTTCCAGG + Intergenic
971743141 4:30545609-30545631 AATGCACACCAAGTTCGTCGGGG - Intergenic
974211737 4:58786103-58786125 TATGCACAGAGACTTCTTCAAGG + Intergenic
978330643 4:107609410-107609432 AATGCATTGTGAGTTCGTGGTGG - Intronic
978987868 4:115038036-115038058 AATGCACAGTGTATTCTCCATGG - Intronic
993274134 5:85834782-85834804 ATTGCACCGTGAGATCTTGGAGG - Intergenic
993360235 5:86965929-86965951 AATACACTGTAAGTTCTTCAAGG + Intergenic
1000138193 5:158374522-158374544 AAGGCACAGTGATTTCTGCAAGG - Intergenic
1010041966 6:71395298-71395320 AATGCGGAGTGATTTCTTGGTGG + Intergenic
1014527408 6:122517388-122517410 AGTGCACAGTAAGTGCTTAGGGG - Intronic
1015298503 6:131626849-131626871 ACTGCAATGTGAGCTCTTCGAGG + Intronic
1016451347 6:144186358-144186380 ATTGCTCATTGAGTTCTGCGCGG + Intronic
1017423594 6:154297669-154297691 AATGCACAATGAGTTCACAGTGG - Intronic
1017918756 6:158853776-158853798 AATGCTCAGTGCATTCTTAGTGG - Intergenic
1017985861 6:159442721-159442743 AAAGCACAGTGGGTTCCTCCTGG - Intergenic
1018831955 6:167450085-167450107 AATACACAGTGAGATCTTTGGGG - Intergenic
1019117295 6:169775317-169775339 CTTGCCGAGTGAGTTCTTCGGGG - Exonic
1022552084 7:31250562-31250584 ACTGCACAGAAAGTTCTTCAAGG + Intergenic
1024120565 7:46234088-46234110 AATGCACAGTGACTTATTTCTGG + Intergenic
1028884241 7:95913376-95913398 AATTCACAGTGAGATCTGGGTGG - Intronic
1031035891 7:116787265-116787287 AATGAACAGTATGTTCTTGGAGG - Intronic
1032107259 7:129043464-129043486 ACTGCACAGTGGGGTCTTCCCGG + Intronic
1034247237 7:149656130-149656152 GAGGCACAGGGAGTTCTTTGGGG - Intergenic
1035935068 8:3827828-3827850 CATGCACTGTGAGTTATTAGTGG - Intronic
1039447196 8:37642387-37642409 ACTGCCCAGTGAGTTCTGGGAGG - Intergenic
1043588385 8:81796188-81796210 AATGCACAGTGAGATGGTGGTGG + Intergenic
1044759001 8:95497042-95497064 GATACAAAGTGAGTTCTTCAAGG - Intergenic
1044759393 8:95501880-95501902 GATACAAAGTGAGTTCTTCAAGG + Intergenic
1046953076 8:120036337-120036359 ATTGCACAGTCTGTTCTTTGGGG + Intronic
1054910908 9:70454455-70454477 AAGATACAGTGAGTTCTTAGAGG - Intergenic
1056100877 9:83299658-83299680 AATGCACAGTGAGTTCTTCGTGG - Intronic
1059769235 9:117412059-117412081 AGTGCACAATGAGTTCTGGGAGG - Intronic
1061834966 9:133322807-133322829 CATGCTCAGTGAGCTCCTCGAGG - Intergenic
1189519410 X:41750447-41750469 AATTCACAATGTGTTCTTTGGGG - Intronic
1190759938 X:53430783-53430805 AAAGCCCAGTGAGTTCTAGGTGG + Exonic
1193919024 X:87403670-87403692 AATGCATAGGGAGTACTTCTGGG - Intergenic
1194634689 X:96330484-96330506 ATTGCACAGTGATTTCTTGATGG - Intergenic
1195086600 X:101419172-101419194 AATGCACAATTAGTGCTTGGTGG + Intronic