ID: 1056100882

View in Genome Browser
Species Human (GRCh38)
Location 9:83299682-83299704
Sequence GGACCCTTGTTCCCTCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056100882_1056100885 -4 Left 1056100882 9:83299682-83299704 CCCAAGTGAGGGAACAAGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data
1056100882_1056100888 3 Left 1056100882 9:83299682-83299704 CCCAAGTGAGGGAACAAGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1056100888 9:83299708-83299730 ATCACCACAGGAATGGTCACTGG No data
1056100882_1056100884 -9 Left 1056100882 9:83299682-83299704 CCCAAGTGAGGGAACAAGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1056100884 9:83299696-83299718 CAAGGGTCCCGCATCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056100882 Original CRISPR GGACCCTTGTTCCCTCACTT GGG (reversed) Intronic
901876039 1:12167508-12167530 GGACCCCTCTTCCCTCACCCCGG + Intronic
903938191 1:26911070-26911092 GTACCCTTGTCCCTTCCCTTTGG + Intronic
905999005 1:42407743-42407765 GGACCCTTTTTCCCTCAAATGGG + Intronic
908311757 1:62891204-62891226 TGACCCTTGTCCCCTATCTTTGG + Intergenic
924707266 1:246510793-246510815 GCCCCCTTGCTACCTCACTTGGG + Intergenic
1063566069 10:7172922-7172944 CCACCCTTGTACACTCACTTTGG - Intronic
1063741517 10:8827003-8827025 AGTCACTTGTTCCCTCATTTAGG + Intergenic
1068623399 10:59211349-59211371 AGACCCTTGTTCTGTCACTCAGG - Intronic
1071128337 10:82362397-82362419 GGACCCTTGCTCTGTCACTCAGG + Intronic
1072170970 10:92861389-92861411 GGACCCAGCTGCCCTCACTTTGG - Intronic
1072247245 10:93554660-93554682 GGAGCCCAGTTCCCTCATTTGGG + Intergenic
1076847441 10:133076228-133076250 GGACCCTTCTTCCCCCACCTTGG + Intronic
1077185055 11:1232132-1232154 GGACCCCTGCTCCCTCAGTGTGG + Exonic
1079111560 11:17607953-17607975 GGACCCCTGATCTCTCCCTTGGG - Intronic
1080140311 11:28910491-28910513 TCACCCTTGTTCATTCACTTTGG - Intergenic
1081153854 11:39664904-39664926 GGACCCTGATTCACACACTTGGG + Intergenic
1084143617 11:67250918-67250940 TGACCCTTTTTCCCAAACTTTGG + Intronic
1089519804 11:119056366-119056388 GGACCCATGCTCTTTCACTTGGG - Intronic
1089667481 11:120029596-120029618 GGACCATTCTTCCCTCAGTAGGG + Intergenic
1091112046 11:132978643-132978665 TGACCCCTGTTCCCTCACCCTGG - Intronic
1097389403 12:58991062-58991084 GGACACCTGTTTCCTCAGTTTGG + Intergenic
1100385302 12:94100432-94100454 TGACTCTTGTTACCTCACCTGGG + Intergenic
1100988141 12:100224546-100224568 GGAGCCTTGTTCTCTCACCCAGG + Intronic
1107564085 13:41584120-41584142 AAACCCATGTGCCCTCACTTAGG - Intronic
1109134151 13:58625793-58625815 GGACCCTTGTGCACTCTCCTGGG + Intergenic
1111841727 13:93457602-93457624 GGAGCTTTCTTCCCTTACTTGGG - Intronic
1114530365 14:23391639-23391661 GGGACCTTGTCCTCTCACTTTGG - Intronic
1116040460 14:39680049-39680071 GGACCATTGTTCCCTTCCTCAGG - Intergenic
1119229838 14:72971114-72971136 TGACCATTGTTCCCTGCCTTAGG - Exonic
1121107303 14:91289398-91289420 GGTCCCTGGTTCCCTAACATGGG + Intronic
1133852719 16:9521167-9521189 GGACCCCTCTTCCCACATTTGGG - Intergenic
1134272130 16:12742038-12742060 GGAGCCTTGTTCTGTCACCTAGG - Intronic
1135710644 16:24714120-24714142 AGTCCCTTGTTCTCTCATTTAGG + Intergenic
1139572331 16:67821035-67821057 GGGCCCTTGTGCCCTCAGTCTGG - Intronic
1140215642 16:73005467-73005489 AGAGTCTTGTTCCCTCACCTAGG - Intronic
1141116114 16:81311275-81311297 GAATCCTTCTTCCCACACTTGGG + Intergenic
1143521073 17:7444743-7444765 GGAGCCTTAGTCCCTCCCTTAGG - Exonic
1146716076 17:35088583-35088605 GGTCCACTGTTCCCTCGCTTGGG - Intronic
1147629295 17:41919362-41919384 GTACCCTTGCTCCTTCCCTTGGG + Intronic
1151850536 17:76687144-76687166 GGACCCTTGCTCCCTGCTTTTGG - Intronic
1152759041 17:82098711-82098733 GGACCCGCGTGCCCGCACTTCGG + Intergenic
1153030522 18:709288-709310 GGCCCCTTCTTCCCTCTCTGAGG - Intronic
1159487997 18:69091534-69091556 AGAGCCTTGTTTCCTCACGTGGG + Intergenic
1162919726 19:13893507-13893529 AGAACCTTGTTCTCTCACCTAGG - Intronic
1163275850 19:16283804-16283826 GTCCCCTTGTTCGCTCACTCGGG + Intergenic
1164307843 19:24020617-24020639 GGAGCCTTGTTCTGTCACCTAGG + Intergenic
1165385902 19:35510578-35510600 GGACCCTAGAGCCCTCACCTGGG + Intronic
1167660504 19:50793487-50793509 GGAGCCTTGCTCCATCACCTAGG - Intronic
927587105 2:24317885-24317907 GGACCTTTGTTCCCTCTCTCAGG + Intronic
929686043 2:44035717-44035739 AACCCATTGTTCCCTCACTTGGG + Intergenic
930920014 2:56741797-56741819 TTACCCTTGTTCCCTCAGTCGGG - Intergenic
931787728 2:65635578-65635600 AGAGTTTTGTTCCCTCACTTGGG + Intergenic
931983961 2:67723582-67723604 GGAGCTTTGTTCCCACACTTTGG - Intergenic
940804038 2:158165782-158165804 GGAGTCTTGTTCTCTCACCTAGG + Intergenic
941701130 2:168605648-168605670 GGACCCTGCTTCCCTGCCTTGGG + Intronic
941720579 2:168808249-168808271 GGTCCCTTGTTCTCTCCCATAGG + Intronic
941826417 2:169902633-169902655 GGAGCCTTGCTCTGTCACTTAGG + Intronic
943161781 2:184263101-184263123 TGCCCCTTCTTCCCTCTCTTGGG - Intergenic
1172526381 20:35602426-35602448 GGACCCCTATACACTCACTTCGG - Intergenic
1174865056 20:54127817-54127839 GGACACTTTTTTCCTCATTTTGG + Intergenic
1175648771 20:60698447-60698469 TGATCCCTGTTCCCTCACTAAGG + Intergenic
1176065983 20:63195293-63195315 GGATTCTCGTTCCCTCGCTTTGG - Intergenic
1179126232 21:38593174-38593196 AGACCCTGGTTCCCACACTGAGG - Intronic
1179600915 21:42476687-42476709 GGACCCTTATCCCCTCACCTAGG - Intronic
1181424861 22:22828186-22828208 GGACCCTTGCTCTGTCACCTGGG - Intronic
1184927809 22:47656609-47656631 TGACCCTTGCTTACTCACTTGGG + Intergenic
1184938271 22:47740645-47740667 GGAGCCTTGTTGGATCACTTGGG - Intergenic
956936121 3:74103689-74103711 GGGCCCTTGTTTCCTGCCTTAGG - Intergenic
959864030 3:111245589-111245611 GGAATATTGTTTCCTCACTTAGG + Intronic
964428355 3:156577056-156577078 TCACCCTTGATCCCTCACTAAGG + Intergenic
965314892 3:167179185-167179207 TCACCCATGTTCCCTCATTTGGG - Intergenic
966877714 3:184332825-184332847 GGCCCCATCTTGCCTCACTTAGG - Intronic
966880048 3:184345033-184345055 GGAGCCTTGAGCCCACACTTGGG - Exonic
969895418 4:10299464-10299486 GCACACATGTTCCCTCATTTGGG - Intergenic
970361490 4:15312708-15312730 GGAACATTGTGCCCTCACATGGG - Intergenic
972205608 4:36768586-36768608 GGATCCTGGTTCTGTCACTTGGG + Intergenic
975311182 4:72905441-72905463 CAAGCCTTGCTCCCTCACTTGGG - Intergenic
975725202 4:77284992-77285014 GGACACTTGTTCCCTTTCTGTGG + Intronic
980923562 4:139112867-139112889 GGAGTCTTGTTCCGTCACTCAGG - Intronic
980961731 4:139482176-139482198 GGACCCCGGTTCCTTCTCTTTGG - Intergenic
982263454 4:153516849-153516871 GGAGTCTTGCTCCGTCACTTAGG + Intronic
984979044 4:185259937-185259959 GGACTCTTCTTCCCTCCCTCAGG + Intronic
987311182 5:16682497-16682519 GCACCCTTGTTAGATCACTTTGG - Intronic
990194621 5:53300841-53300863 GGACACATTTTCCCTCACTGGGG - Intergenic
991357246 5:65781807-65781829 GGACCCTTTTTTCCTTACATAGG + Intronic
1000683941 5:164223731-164223753 GTAGCCTAGTTCCCTCTCTTGGG - Intergenic
1002080273 5:176733442-176733464 GGAGCCCTGTTCCCTCACGCGGG + Intergenic
1002485215 5:179530490-179530512 GGAGCCTGGTTTCCTCACTGCGG + Intergenic
1005659748 6:27984508-27984530 GTACCTTTGTTGCCTCCCTTGGG + Intergenic
1007124307 6:39412009-39412031 GGACCTTGGTTCACTCACTAAGG + Intronic
1015639715 6:135318272-135318294 GGGTCCTTGTCCCATCACTTAGG + Intronic
1019900832 7:4019695-4019717 GCACCATCCTTCCCTCACTTGGG + Intronic
1022875130 7:34520693-34520715 GGACACCTGTGCCCTCACTCAGG + Intergenic
1029338802 7:99926071-99926093 GGACTGTTGTTCCAGCACTTTGG + Intronic
1029606300 7:101601355-101601377 GGAATCTTGTTGCCCCACTTTGG + Intergenic
1030620548 7:111785621-111785643 CCAGCCTTGTTCCCTCTCTTGGG + Intronic
1031233189 7:119136659-119136681 GGACACTTGTGCTCTCAATTAGG + Intergenic
1032795312 7:135271544-135271566 GGCCCCTTGCTCCCTCTCTTTGG - Intergenic
1035996746 8:4555569-4555591 GGATCATTGATACCTCACTTTGG + Intronic
1036491628 8:9231539-9231561 GGACCGTTGTTCCATCTGTTAGG + Intergenic
1036636569 8:10554672-10554694 GGAGCCCTGTTCCCTAGCTTAGG - Intergenic
1037142677 8:15537544-15537566 TGACCCTCCTTCCCTGACTTAGG - Intronic
1041667640 8:60461427-60461449 TAGCCCTTGTTCCCACACTTAGG + Intergenic
1056100882 9:83299682-83299704 GGACCCTTGTTCCCTCACTTGGG - Intronic
1059221715 9:112627726-112627748 GGAGCCTTGCTCCCTCACCCAGG - Intronic
1059463331 9:114449273-114449295 GGACCTTTGTTCAGCCACTTGGG + Intronic
1061318380 9:129812318-129812340 GGACCCGTGTTCTCTAACTAGGG + Intergenic
1185586295 X:1244190-1244212 GGAGCCTTGCTCTCTCACTCAGG - Intergenic
1187390566 X:18884052-18884074 GGAGCCTCCTGCCCTCACTTGGG - Intergenic
1187403450 X:18982984-18983006 TTAGCCTTGTTTCCTCACTTAGG - Intronic
1190289077 X:48980088-48980110 GGTCCCTTATTCCCCCACTCGGG - Intronic
1190507352 X:51139260-51139282 GGACCCGTGTGTCCTCACTGAGG - Intergenic
1192222084 X:69204141-69204163 AAACCCTTGGTTCCTCACTTTGG + Intergenic
1194542887 X:95196576-95196598 GGGCCCATGCTCCTTCACTTTGG + Intergenic
1200135515 X:153872767-153872789 GGACCCTGCTTCCCTCACGATGG - Intronic
1200395748 X:155986613-155986635 GGATCTTTGTTGCCTCACGTTGG + Intergenic
1200937314 Y:8749486-8749508 GGATCAGTGTTCCCACACTTCGG + Intergenic
1200965187 Y:9028936-9028958 GGAGCCGTGTTCTCTCACTTTGG + Intergenic