ID: 1056100883

View in Genome Browser
Species Human (GRCh38)
Location 9:83299683-83299705
Sequence GGGACCCTTGTTCCCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056100883_1056100884 -10 Left 1056100883 9:83299683-83299705 CCAAGTGAGGGAACAAGGGTCCC 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1056100884 9:83299696-83299718 CAAGGGTCCCGCATCACCACAGG No data
1056100883_1056100885 -5 Left 1056100883 9:83299683-83299705 CCAAGTGAGGGAACAAGGGTCCC 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data
1056100883_1056100888 2 Left 1056100883 9:83299683-83299705 CCAAGTGAGGGAACAAGGGTCCC 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1056100888 9:83299708-83299730 ATCACCACAGGAATGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056100883 Original CRISPR GGGACCCTTGTTCCCTCACT TGG (reversed) Intronic
903289051 1:22296345-22296367 GGGACCCTCCTTCTCTCTCTAGG - Intergenic
903380585 1:22894229-22894251 GGGACCTTAGTGCCCACACTTGG - Intronic
905684119 1:39896645-39896667 GGGACCTTTCTTTCCTCACAAGG - Exonic
905999004 1:42407742-42407764 TGGACCCTTTTTCCCTCAAATGG + Intronic
906024721 1:42663819-42663841 GGGACCCTTGATTCCTCACTGGG + Intronic
906224019 1:44106201-44106223 GGGATCCTTGGCCCCTCCCTGGG - Intergenic
910051008 1:82973809-82973831 AGTTCCCTTGTTCCCTCACAGGG - Intergenic
910237382 1:85048937-85048959 CTGAACCTTGTTCCCTCCCTGGG + Intronic
920437807 1:205959473-205959495 TGGACCCCAGTTCCCTCCCTAGG + Intergenic
1068370751 10:56110148-56110170 GGTTCCCTTGTTCCCTCACAGGG - Intergenic
1070070910 10:73088406-73088428 GGGACCAGTATTCCCTCCCTTGG + Intronic
1070738890 10:78888849-78888871 GGGACACTGGATCCCTCACAAGG + Intergenic
1072247244 10:93554659-93554681 GGGAGCCCAGTTCCCTCATTTGG + Intergenic
1077043460 11:534580-534602 GGGTCCCTTTTCCCATCACTGGG - Intronic
1077195345 11:1277078-1277100 GGCATCCTTGTTCCCTCGCTGGG + Exonic
1082744753 11:56949659-56949681 GGGACACCTGCTCCTTCACTGGG - Intergenic
1084858768 11:72004918-72004940 GGGACCCTTCCTGCCTCACGAGG + Intronic
1084957328 11:72698243-72698265 GGTACCCAAGTTCCATCACTGGG - Intronic
1085503259 11:77041043-77041065 GGGCCCCTCGCTCCCACACTCGG + Exonic
1085689362 11:78652916-78652938 GGGAGCCTTGCTCCACCACTGGG - Exonic
1087894473 11:103572509-103572531 GGTTCCCTGGTTCCCTGACTTGG + Intergenic
1088506410 11:110531955-110531977 GGGGCCCATGTTGCTTCACTTGG - Intergenic
1088985205 11:114899672-114899694 GGGACTCTTGTTCCAAGACTTGG + Intergenic
1089667480 11:120029595-120029617 AGGACCATTCTTCCCTCAGTAGG + Intergenic
1091696750 12:2632962-2632984 GGTACCCTAGTTCCTGCACTGGG - Intronic
1101241882 12:102847136-102847158 GGGATCCTTCCACCCTCACTTGG + Intronic
1102347616 12:112169758-112169780 TGGACCCCTGCTCCCTCGCTCGG + Intronic
1103480648 12:121247966-121247988 GGGACTCTTGGTCTCTCTCTTGG + Intronic
1103929033 12:124439440-124439462 GGGTCCCTGTTTCCCTCTCTGGG - Intronic
1103929050 12:124439534-124439556 GGGTCCCTGTTTCCCTCTCTGGG - Intronic
1104395636 12:128430005-128430027 GGCACCATTTTTACCTCACTGGG + Intronic
1106567486 13:30898746-30898768 GGTACCCTGGTTCCCACACGTGG + Intergenic
1106637065 13:31540351-31540373 GGGATCCTTGTTGTGTCACTTGG + Intergenic
1108132753 13:47320712-47320734 GGGACCCTTGTAATTTCACTGGG - Intergenic
1111090312 13:83437956-83437978 GGGACCTTTATTTCCTCTCTGGG - Intergenic
1111687512 13:91519390-91519412 GGGGCCCTTGCTCCAACACTGGG - Intronic
1113368194 13:109697918-109697940 GGGCCCCATTTTCCTTCACTTGG - Intergenic
1113942309 13:114024688-114024710 GGGACCCTCCCTCCCTCACGGGG - Intronic
1115928034 14:38459306-38459328 GGGACCTCTGTTCACTGACTGGG + Intergenic
1116620366 14:47194545-47194567 TGGACCCTTGGGCCCTCTCTAGG + Intronic
1120853510 14:89192901-89192923 GGGTCCCTTGGTCCCCCACAGGG + Intronic
1121107302 14:91289397-91289419 GGGTCCCTGGTTCCCTAACATGG + Intronic
1124823083 15:33067164-33067186 GGGACCCTTCTTCTCCCACCTGG + Intronic
1127083956 15:55407893-55407915 GCCACCCTTCTTCCTTCACTGGG - Intronic
1129039115 15:72670590-72670612 GTGTTCCTTTTTCCCTCACTGGG + Intergenic
1129399627 15:75274440-75274462 GTGTTCCTTTTTCCCTCACTGGG + Intronic
1129851292 15:78795381-78795403 GGGCCAGTTCTTCCCTCACTGGG - Intronic
1131590307 15:93741084-93741106 GGATCCCTTCTGCCCTCACTTGG + Intergenic
1138782571 16:59807217-59807239 TGGACCCTTGAGCTCTCACTAGG - Intergenic
1142395639 16:89829674-89829696 AGGGCCCTTGTTCCTTCACCAGG + Intronic
1142827858 17:2525469-2525491 GGGACTCTGCTTCCCACACTAGG + Intergenic
1143016858 17:3895413-3895435 GGGACCCTTTTCTGCTCACTTGG + Intergenic
1143049034 17:4107500-4107522 GCCACCCTTCTTGCCTCACTTGG - Intronic
1144683463 17:17210764-17210786 GGAACCCCTATTCCCTCACAAGG + Intronic
1146716077 17:35088584-35088606 GGGTCCACTGTTCCCTCGCTTGG - Intronic
1147938650 17:44029327-44029349 GGGGCCCTTCTTCCCTGACAGGG - Intergenic
1149995124 17:61402206-61402228 GGGTCCCTTGTACCGTCAATAGG + Intronic
1155441809 18:25870108-25870130 TGAACCCTTGGTCCCTCACTGGG + Intergenic
1156112084 18:33740411-33740433 GGAACCCTTGGTTCCTCTCTGGG - Exonic
1160265266 18:77336421-77336443 GGGACCCTGGTGTCCTCACAGGG + Intergenic
1163179958 19:15592290-15592312 GGCCCCCTTGTTCACTGACTAGG + Intergenic
1163275849 19:16283803-16283825 GGTCCCCTTGTTCGCTCACTCGG + Intergenic
1163550853 19:17965894-17965916 AGGACCTTTGTTCCCTCCCCTGG - Intronic
1164913953 19:32034920-32034942 GTCACTCTTGTGCCCTCACTGGG - Intergenic
1165385901 19:35510577-35510599 GGGACCCTAGAGCCCTCACCTGG + Intronic
1167674976 19:50878212-50878234 TGGAGCCTTGTTCCCTCTGTTGG + Intronic
930920015 2:56741798-56741820 CTTACCCTTGTTCCCTCAGTCGG - Intergenic
940067659 2:149647961-149647983 GGTACCCATGTTCTCTCATTGGG + Intergenic
948633470 2:239317485-239317507 GGGACCCTTCTTTACTCTCTTGG - Intronic
1173499354 20:43540912-43540934 GGGACCCGTGTTGCCCCACCAGG + Exonic
1174356029 20:49998402-49998424 GGGTCCTTATTTCCCTCACTTGG - Intergenic
1174519793 20:51120632-51120654 AGCATCCTTGTTCCTTCACTAGG + Intergenic
1179631345 21:42680428-42680450 GTGACCCTGGGTCCCCCACTTGG + Intronic
1180248367 21:46563329-46563351 GGTCCCAGTGTTCCCTCACTGGG - Intronic
1180817834 22:18803315-18803337 GGGAGGCTTGTTCACTCACATGG - Intergenic
1181204049 22:21237768-21237790 GGGAGGCTTGTTCACTCACATGG - Intergenic
1183468209 22:37990737-37990759 GGCAACCTTCTTCCCTCTCTGGG + Intronic
1184118855 22:42437704-42437726 GTGACCCTTCTTCCCCCTCTAGG + Intergenic
1185076808 22:48687541-48687563 GGGAACCTGGTGCCCTCACTAGG - Intronic
1203222872 22_KI270731v1_random:57647-57669 GGGAGGCTTGTTCACTCACATGG + Intergenic
1203267957 22_KI270734v1_random:29166-29188 GGGAGGCTTGTTCACTCACATGG - Intergenic
950852575 3:16076840-16076862 TGGACCCTTGTGTCCCCACTTGG - Intergenic
953880840 3:46690575-46690597 CAGACCCTGGTACCCTCACTTGG + Intronic
957547938 3:81663859-81663881 GGTTCCCTTGTCCCCTCACAGGG - Intronic
965314893 3:167179186-167179208 GTCACCCATGTTCCCTCATTTGG - Intergenic
966766665 3:183469264-183469286 GGGAACCCTGTGGCCTCACTGGG + Intergenic
966880049 3:184345034-184345056 GGGAGCCTTGAGCCCACACTTGG - Exonic
969660884 4:8526756-8526778 GGGGCCCCTCTGCCCTCACTGGG + Intergenic
969895419 4:10299465-10299487 GGCACACATGTTCCCTCATTTGG - Intergenic
971721261 4:30247491-30247513 GGAACCCTGGTAGCCTCACTAGG - Intergenic
971914930 4:32856746-32856768 GGGGCTCTTCCTCCCTCACTGGG - Intergenic
975311183 4:72905442-72905464 GCAAGCCTTGCTCCCTCACTTGG - Intergenic
982255966 4:153452073-153452095 GCGGCCCTTGTCCCCTCCCTAGG - Intergenic
990194622 5:53300842-53300864 GGGACACATTTTCCCTCACTGGG - Intergenic
994298668 5:98121119-98121141 GGTACCCAGGTTCTCTCACTGGG + Intergenic
1000355067 5:160386457-160386479 GGGACCCTTGTGACCACAATGGG + Intergenic
1000418640 5:161011665-161011687 GGGCCACTTGCTCCCTGACTGGG - Intergenic
1002080272 5:176733441-176733463 CGGAGCCCTGTTCCCTCACGCGG + Intergenic
1004865041 6:19845207-19845229 CGGACCCTCGTTCCCACTCTTGG + Intergenic
1006581894 6:35082149-35082171 GGGACCCATGATCTCTCACCTGG + Intronic
1007707021 6:43797385-43797407 GGGAGCCATGTTCCTCCACTTGG - Intergenic
1007719825 6:43878381-43878403 GGGAGCCTTCTTCCCTCCCCAGG + Intergenic
1014110074 6:117610469-117610491 GGCACCCTTGTTCCTTCACTTGG + Intergenic
1023504442 7:40885494-40885516 GGGACCCTTGTTCCCTTTCCTGG + Intergenic
1025635647 7:63317504-63317526 GGGACCCCAGTTCATTCACTTGG + Intergenic
1025647049 7:63430676-63430698 GGGACCCCAGTTCATTCACTTGG - Intergenic
1027507816 7:79040192-79040214 GGGGCCCTTCCTCCTTCACTCGG + Intronic
1027624999 7:80533677-80533699 AGGACCATTGTGTCCTCACTTGG - Intronic
1030620546 7:111785620-111785642 GCCAGCCTTGTTCCCTCTCTTGG + Intronic
1033926371 7:146466168-146466190 GGGAACCTAATCCCCTCACTTGG - Intronic
1036756856 8:11476802-11476824 GGGCCCCGTGTTCCCTTCCTTGG - Intergenic
1037504149 8:19514172-19514194 GGGACCCCTGTCCTCTCGCTGGG - Intronic
1039853225 8:41390055-41390077 GGAACCCTGGTTCCCTCTATTGG - Intergenic
1047038806 8:120970013-120970035 GGGCCCCATTTTCCCTCCCTAGG + Intergenic
1048310860 8:133321573-133321595 GGGACCCTTGCTCCTGCCCTAGG + Intergenic
1049193714 8:141303965-141303987 GGCACCCTTATTCCTGCACTGGG + Intronic
1052716761 9:32127199-32127221 GGGAGCCATGGTCTCTCACTTGG + Intergenic
1055751285 9:79508387-79508409 GATTCCCTTGTTCCCTCACCAGG + Intergenic
1056100883 9:83299683-83299705 GGGACCCTTGTTCCCTCACTTGG - Intronic
1056781399 9:89553737-89553759 GGGAGCCTTGTTTCCGCTCTGGG + Intergenic
1057436560 9:95045581-95045603 GGGACCCTTGCACCCACCCTGGG + Intronic
1059983350 9:119797418-119797440 GGGACTCTTTTTCCCTTTCTAGG - Intergenic
1060400176 9:123344086-123344108 GGGACTGCTGTTACCTCACTGGG - Intergenic
1061318379 9:129812317-129812339 GGGACCCGTGTTCTCTAACTAGG + Intergenic
1185673465 X:1830013-1830035 CGGACCCTTGGCCCTTCACTGGG + Intergenic
1190289078 X:48980089-48980111 TGGTCCCTTATTCCCCCACTCGG - Intronic
1190992382 X:55565931-55565953 GGTACCCAGGTTCTCTCACTGGG + Intergenic
1192630180 X:72771324-72771346 GTGACCCTTGTTTCCTGACCAGG + Intergenic
1192651530 X:72949480-72949502 GTGACCCTTGTTTCCTGACCAGG - Intergenic
1196885867 X:120244948-120244970 GGAACTCTTGTTCTCTGACTGGG - Intergenic