ID: 1056100885

View in Genome Browser
Species Human (GRCh38)
Location 9:83299701-83299723
Sequence GTCCCGCATCACCACAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056100882_1056100885 -4 Left 1056100882 9:83299682-83299704 CCCAAGTGAGGGAACAAGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data
1056100883_1056100885 -5 Left 1056100883 9:83299683-83299705 CCAAGTGAGGGAACAAGGGTCCC 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data
1056100877_1056100885 20 Left 1056100877 9:83299658-83299680 CCACGAAGAACTCACTGTGCATT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056100885 Original CRISPR GTCCCGCATCACCACAGGAA TGG Intronic
No off target data available for this crispr