ID: 1056100997

View in Genome Browser
Species Human (GRCh38)
Location 9:83300798-83300820
Sequence GTGAATGTACAGATGTACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056100995_1056100997 -4 Left 1056100995 9:83300779-83300801 CCTTTCCTAATAAAGATAAGTGA 0: 1
1: 0
2: 0
3: 19
4: 220
Right 1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG No data
1056100996_1056100997 -9 Left 1056100996 9:83300784-83300806 CCTAATAAAGATAAGTGAATGTA 0: 1
1: 0
2: 1
3: 34
4: 328
Right 1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056100997 Original CRISPR GTGAATGTACAGATGTACGA AGG Intronic
No off target data available for this crispr