ID: 1056109227

View in Genome Browser
Species Human (GRCh38)
Location 9:83378069-83378091
Sequence ATGCTGTAAGTGAGGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056109227_1056109230 -4 Left 1056109227 9:83378069-83378091 CCTGGTTTCCTCACTTACAGCAT 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1056109230 9:83378088-83378110 GCATCATGGAGAAGTTTAAATGG No data
1056109227_1056109231 -3 Left 1056109227 9:83378069-83378091 CCTGGTTTCCTCACTTACAGCAT 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1056109231 9:83378089-83378111 CATCATGGAGAAGTTTAAATGGG No data
1056109227_1056109232 14 Left 1056109227 9:83378069-83378091 CCTGGTTTCCTCACTTACAGCAT 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1056109232 9:83378106-83378128 AATGGGTTAATTCATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056109227 Original CRISPR ATGCTGTAAGTGAGGAAACC AGG (reversed) Intronic
901850857 1:12014355-12014377 ATGATGGAGGTGAGGAAACTGGG - Intergenic
902138280 1:14329859-14329881 ATGCTAGAAGTGAAGAAAACAGG - Intergenic
902238726 1:15074344-15074366 AGGCAGTATGTGAGAAAACCAGG + Intronic
902532037 1:17096795-17096817 ATGTTACAAGTGAGGAAACTGGG - Intronic
903268298 1:22172046-22172068 ACTCTGCAGGTGAGGAAACCGGG + Intergenic
903813615 1:26048431-26048453 ATGCTGCAAGAGAGGACAGCTGG - Intergenic
905266726 1:36759498-36759520 ATGCTGTGGGTGAGGAATTCAGG + Intergenic
905275058 1:36812196-36812218 ATGCTGTCAGAGAGGTCACCTGG - Intronic
906964309 1:50441695-50441717 ATTTTATAAATGAGGAAACCAGG + Intronic
907938305 1:59062531-59062553 ATGCTGTTGGAGAGGAAACTGGG - Intergenic
908745072 1:67368452-67368474 ATTATATAAATGAGGAAACCAGG + Intronic
910217665 1:84858584-84858606 AAGATGGAAGTGAGGAAACCTGG + Intronic
912092935 1:106104400-106104422 ATTCTTTAAGGGAGGACACCTGG + Intergenic
913584463 1:120260241-120260263 ATTTTTTAAGTGAGGGAACCAGG + Intergenic
913623719 1:120638118-120638140 ATTTTTTAAGTGAGGGAACCAGG - Intergenic
914566459 1:148872097-148872119 ATTTTTTAAGTGAGGGAACCAGG + Intronic
914606360 1:149258143-149258165 ATTTTTTAAGTGAGGGAACCAGG - Intergenic
915008290 1:152661178-152661200 ATGTTGTAAGTGAGGAAGTAGGG - Intergenic
915010741 1:152683920-152683942 ATGTTGTAAGTGAGGAAATAGGG - Intergenic
915033663 1:152905144-152905166 AAGATGTAAGAGAGGAAAGCAGG + Intergenic
915333839 1:155129352-155129374 TTCCTGAAAGAGAGGAAACCTGG - Intronic
915492599 1:156259441-156259463 GGGCTGGAAGTGAGGAGACCTGG + Intronic
917251586 1:173068257-173068279 AGGCAGTAAGGGAGGAAACAAGG + Intergenic
917535158 1:175869201-175869223 ATTCTATAAGGGAGGAAACTGGG - Intergenic
917648590 1:177052913-177052935 AGGCTGTAAGAAAGGAAGCCAGG - Intronic
918087171 1:181255640-181255662 ATGTTGGAAGAGGGGAAACCAGG + Intergenic
919978513 1:202628189-202628211 ATTTTGTAATTGAGGAAACTGGG + Intronic
920433965 1:205936399-205936421 ATGGTGTGTGTGGGGAAACCAGG + Intronic
920739544 1:208567546-208567568 ATGAAGTAAGGGAGGAAACAAGG - Intergenic
921318226 1:213912265-213912287 ATGTTGTAAATGAGTAAAGCAGG + Intergenic
922358492 1:224798947-224798969 ATGCTGTGAGATAGGAAATCCGG - Intergenic
1063350421 10:5349162-5349184 CTGCTGTAAGTTAGGAAAACAGG - Intergenic
1063454307 10:6172516-6172538 ATGTTCCAAATGAGGAAACCGGG + Intronic
1064079220 10:12294791-12294813 ATGCTGTTACTGAGAAACCCCGG - Intergenic
1064121733 10:12624903-12624925 ATTCTGTCAGCCAGGAAACCTGG - Intronic
1064886287 10:20116088-20116110 AAGCTGCATGTTAGGAAACCAGG + Intronic
1066034338 10:31467129-31467151 AAGGTGTGAGTGAAGAAACCCGG + Intronic
1066722086 10:38350457-38350479 ATGTTGTAAATGGGGAAAACTGG - Intergenic
1068319100 10:55387292-55387314 AGGCTGAAAGGGAGGAAACATGG + Intronic
1069172743 10:65254190-65254212 ATGCTGGAAGCGGGGAAACATGG + Intergenic
1071832868 10:89389775-89389797 ATTGTGTAGGTGAGGAAACAAGG + Intronic
1071995133 10:91140472-91140494 AAGCTGTATGTCAGGAAACAGGG - Intergenic
1072411960 10:95211019-95211041 ATGCAGTAGGTGAGGGATCCAGG + Intronic
1072550625 10:96474521-96474543 AGGCTGTAAGGAAGGAAACTGGG + Intronic
1074241525 10:111644071-111644093 ATGCTGTAATTGAGGGACCTAGG - Intergenic
1074520614 10:114219162-114219184 ATGATTTAAGTGAAGAAAACAGG + Intronic
1075031364 10:119026804-119026826 TTGATGTAAGTCATGAAACCAGG - Intergenic
1075450654 10:122549810-122549832 ATGTTGGAAGTGATGAAACGGGG - Intergenic
1078757550 11:14225085-14225107 CTGCTGTGAGTGAGCAGACCTGG - Intronic
1078893991 11:15581890-15581912 ATTTTGTAACTGAGGGAACCGGG + Intergenic
1082735180 11:56847195-56847217 GTGCTGTGTGGGAGGAAACCTGG - Intergenic
1084064668 11:66696927-66696949 AAGCTGGAAGTGGGGAAACCAGG - Intronic
1085357514 11:75852578-75852600 ATGGTGTAAGAGAGGAAGCATGG + Intronic
1086681080 11:89673469-89673491 ATGCTGCTAGTGAGAGAACCAGG + Intergenic
1088498662 11:110459443-110459465 ATGTTGTAGGTGGGGAAACAAGG + Intronic
1089971598 11:122698072-122698094 ATTCTCTCAGTGAGGAAACCAGG + Intronic
1091438604 12:494938-494960 TAGCTACAAGTGAGGAAACCTGG + Intronic
1091992740 12:4969479-4969501 ATGTTGCCAGTGAGGAAACTAGG + Intergenic
1093470823 12:19500536-19500558 ATTTTGCAAATGAGGAAACCAGG - Intronic
1093805133 12:23422987-23423009 ATTCTGTAGATGAGGAAACTGGG + Intergenic
1094223292 12:28017873-28017895 ATTTTGTAGGTGAGGAAACATGG - Intergenic
1094501013 12:31020819-31020841 ATGCTTTAAGTCAGGGACCCAGG + Intergenic
1096371084 12:51069615-51069637 AAGCTGTATGTGAGGAAAGGTGG + Intronic
1097494935 12:60319627-60319649 ATTTTGTAAGTGAGCAAAGCAGG + Intergenic
1099464510 12:82966544-82966566 TTACTTTAAGTCAGGAAACCTGG - Intronic
1099673846 12:85731434-85731456 ATGCTGTAAGGCTGGAGACCTGG + Intergenic
1099960184 12:89389540-89389562 ATGCTGTAATTGAAGCTACCTGG - Intergenic
1100480759 12:94976232-94976254 ATATAGTAAGTGAGAAAACCAGG + Intronic
1101529087 12:105558037-105558059 ATTGTGGAAGTGAGGAAAGCAGG - Intergenic
1107689931 13:42943484-42943506 AGGCTATATGTGAGGAAACGAGG + Intronic
1109258137 13:60109269-60109291 GTTCTGTAAGTGAGAAATCCTGG - Intronic
1112726452 13:102310300-102310322 ATACTCTAAGTGAGGAAAGGGGG - Intronic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1118489833 14:66248148-66248170 ATGCTGTCAGTGCAGAAAGCAGG + Intergenic
1118780752 14:69006127-69006149 ATGTCATAGGTGAGGAAACCAGG + Intergenic
1118838349 14:69492650-69492672 ATGAGGTAGGTGAGGAAACTGGG - Intronic
1119220368 14:72901466-72901488 ATGTTGTGAGTGAGGGAAACAGG - Intergenic
1120997806 14:90429704-90429726 ATGAAGAAACTGAGGAAACCGGG + Intergenic
1121868680 14:97387039-97387061 ACTCAGTAAGTGAGGGAACCAGG + Intergenic
1124494141 15:30176128-30176150 ATTTTGTAATTGAGGAAACTGGG + Intergenic
1124749429 15:32362517-32362539 ATTTTGTAATTGAGGAAACTGGG - Intergenic
1125717266 15:41826470-41826492 AGGCAGGATGTGAGGAAACCAGG - Exonic
1126465178 15:48955303-48955325 ATGATGTAAGTGAGTGAAGCTGG + Intronic
1127502619 15:59569031-59569053 CTGCTGTAAGGGATGACACCGGG - Intergenic
1128705218 15:69833319-69833341 GTGCTGTGAGTGAGGAATCCAGG + Intergenic
1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG + Intergenic
1130253098 15:82313585-82313607 ATGCTGGCTTTGAGGAAACCAGG - Intergenic
1130789799 15:87142006-87142028 ATGCTGTAAGCCATCAAACCTGG - Intergenic
1130847283 15:87759154-87759176 ATTCTGTAAATAAGGAAATCTGG + Intergenic
1134042773 16:11081049-11081071 ACGCTGCAATTGAGGAAGCCTGG + Intronic
1135206925 16:20492206-20492228 AGGCTGTAAGTGGGGCCACCAGG + Intergenic
1135211960 16:20531426-20531448 AGGCTGTAAGTGGGGCCACCAGG - Intergenic
1136608442 16:31352123-31352145 ATGATGTAAGTGAGGAAGGAGGG - Intergenic
1139937579 16:70582524-70582546 ATTCTGCAAATGAGGAAACTGGG - Intronic
1142551034 17:739692-739714 ATGCTGTAGATGAAGAAACTGGG + Intronic
1148550235 17:48545798-48545820 AGCCTGAAAGTGAGGAAAGCAGG - Intergenic
1152788088 17:82262342-82262364 ATGTTGCAAATGAGGAAACTGGG - Intronic
1152907791 17:82978468-82978490 CTGCTGTGAGTGAGGAATTCCGG + Intronic
1153225326 18:2895482-2895504 ATTCTGTAGGTCAGGAACCCCGG + Intronic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1154104101 18:11505216-11505238 ATGCTGCAAGTATGGAAGCCAGG + Intergenic
1155129403 18:22916453-22916475 TTGGTGGAAGTCAGGAAACCTGG - Intronic
1155132580 18:22953206-22953228 CTGCTATAAATGAGGAAAGCAGG - Intronic
1157283567 18:46361925-46361947 TTTCTGTAAGTGGGGAAACGGGG - Intronic
1158780251 18:60640614-60640636 ATACTGTAAGTGAGGATGCTGGG - Intergenic
1159133080 18:64303467-64303489 ATATTATCAGTGAGGAAACCAGG + Intergenic
1160051510 18:75438349-75438371 AGGCTGTGAGGGAGGATACCAGG + Intergenic
1160186980 18:76683306-76683328 ACGTTATAAATGAGGAAACCAGG - Intergenic
1160888348 19:1363087-1363109 ATGCTGCCAGTGGGGAAGCCCGG - Intronic
1161814936 19:6494282-6494304 TTGCTGTAAGAGAGGAAAGAGGG + Intergenic
1162494659 19:11016923-11016945 ATTCTGTAAGAAGGGAAACCAGG - Intronic
1163523596 19:17806988-17807010 ATGCTGTAAGTGGGAATAGCTGG + Intronic
1164504105 19:28843961-28843983 ATTCTGTAAATGAGCAAACAGGG - Intergenic
1168710714 19:58498524-58498546 AGGCTGTGTGTGAGGGAACCTGG - Exonic
926223157 2:10949306-10949328 ACTCTGTAAGTGAGGAAACCAGG + Intergenic
926455117 2:13057592-13057614 AAGCTGAAAGTTAGGACACCTGG + Intergenic
927238466 2:20899554-20899576 ATGCAGTAACTCAGGAATCCTGG + Intergenic
928197970 2:29228669-29228691 ATGCTGTCGCTGAGGAAGCCTGG + Intronic
928433287 2:31237704-31237726 ATGCTATAAGTAAGAAAAACTGG - Intronic
928686508 2:33755456-33755478 ATGTAGAAAGTGAGGAATCCAGG + Intergenic
928875862 2:36038533-36038555 ATTCTCTATGTAAGGAAACCAGG - Intergenic
928935115 2:36668209-36668231 ATGCTGTGAGTGAGGTTAGCGGG + Intergenic
932686559 2:73875603-73875625 AACCAGTAAGTGAGGAAGCCAGG - Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935639418 2:105276673-105276695 AAGCTGTAACTGAGAACACCAGG + Intronic
936624476 2:114133557-114133579 ATTTTGTAGGTGAGGAAATCCGG + Intergenic
938322763 2:130376111-130376133 TTACTAGAAGTGAGGAAACCCGG - Intergenic
938578796 2:132627856-132627878 AAGCTGTAAATGAGGAAAGGGGG - Intronic
938801960 2:134771875-134771897 AAAATGTAAGGGAGGAAACCAGG + Intergenic
939719844 2:145634912-145634934 GAGCTGTATGTCAGGAAACCAGG + Intergenic
939992877 2:148892055-148892077 ATTCTGCAAATGAGGAAACTTGG + Intronic
940664945 2:156597412-156597434 ATGCTACAGATGAGGAAACCAGG - Intronic
940682056 2:156798785-156798807 AAGATGTAAGTGATAAAACCAGG - Intergenic
942700932 2:178709649-178709671 GTGCTGCAAGTCAGGAAAGCAGG - Exonic
943107648 2:183566518-183566540 CTGCTGAAAGTGAGGGAAACAGG + Intergenic
944730561 2:202512756-202512778 ATTCTGCAAGTGAGTAAACTTGG + Intronic
945760486 2:213908068-213908090 ATACAGTAAGTGAGCAAATCAGG - Intronic
946625789 2:221611063-221611085 ATGCTGTGAGTATAGAAACCAGG + Intergenic
1171017754 20:21557328-21557350 AGGCTGAAAATGAGTAAACCTGG - Intergenic
1171940885 20:31328694-31328716 ATGCAGTTTGTGAGGAAAGCAGG - Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173643181 20:44617524-44617546 AAGCTGAAAGTGAGGAGACTTGG + Intronic
1173678487 20:44859101-44859123 ATGCTGTAAGGTATGACACCAGG + Intergenic
1175951699 20:62587131-62587153 CTGCTGTAAGTGGGGAACGCTGG + Intergenic
1178031059 21:28526692-28526714 ATGCAGTAATTCAGGAAACCTGG - Intergenic
1178041009 21:28641144-28641166 GTGGTGAAAGTGAGGAAACAAGG - Intergenic
1179163342 21:38915754-38915776 AAGCTGTGAGTGAAGAAGCCAGG - Intergenic
1179224059 21:39436964-39436986 ATGCAGTTAGTGGGGAAGCCAGG - Intronic
1180071763 21:45440337-45440359 TTGCTGTCTGTGAGGAAAGCGGG + Intronic
1181345806 22:22219835-22219857 ATGCTGGGAGTGAGGACACCTGG - Intergenic
1182943904 22:34304484-34304506 ATTTTGTAAGTGAGGAGAACTGG - Intergenic
1183016435 22:34991831-34991853 AGAATGTAAGTGAAGAAACCTGG - Intergenic
1184065887 22:42120299-42120321 CTGCTGAAAGTGAGGAAGACGGG + Intergenic
949396876 3:3623695-3623717 ATGCTGTAAGTGAGAAGTTCAGG - Intergenic
951571487 3:24067922-24067944 ATTTTGTAGGTGAGGAAACTAGG + Intergenic
953156729 3:40382072-40382094 ATACTGGTAGTTAGGAAACCTGG - Intergenic
953767271 3:45753243-45753265 ATGCTGTGAGTCAGGAATTCAGG + Intergenic
954760474 3:52870285-52870307 TTGCAGTAAGTTTGGAAACCAGG + Intronic
956166792 3:66403513-66403535 ATTATGTGAGTGAGGAAAGCAGG + Intronic
956310609 3:67875119-67875141 ATACTGTATGTGAGGACAGCAGG + Intergenic
956638961 3:71396408-71396430 ATTTTGTAAATGAGGAAACTGGG + Intronic
956810659 3:72861227-72861249 ATTGTGTAAATGAGGAAACTTGG + Intronic
957580662 3:82068252-82068274 ATGAGGAAAGTGAGGAAACTTGG - Intergenic
959111650 3:102129945-102129967 CTGCTATATGTAAGGAAACCTGG + Intronic
959557495 3:107738875-107738897 ATTTTGTAAATGAGGAAACTAGG + Intronic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
959802992 3:110517541-110517563 ATGGTGGAAGTGAAGAAAGCAGG - Intergenic
960100740 3:113740223-113740245 ATGCTGTAAGTGTAGTAAACTGG - Intronic
961360648 3:126365152-126365174 TGGCTGTAAGCGAGGAAACTTGG - Intergenic
961933565 3:130559401-130559423 GTGATGTAGGTGAGGAAACAGGG + Intergenic
962318944 3:134375351-134375373 GTGTTGTAAATGAGGACACCAGG + Exonic
962728414 3:138256934-138256956 ATACTGGAAGTAAGAAAACCTGG + Intronic
962833092 3:139161247-139161269 ATGGTGGAAGTGAGGACACCTGG + Intronic
964055862 3:152456358-152456380 AAGCTGTAAATTAGCAAACCTGG - Exonic
966016895 3:175151194-175151216 ATGCGGTAAGTGAGAAAACAAGG - Intronic
966074024 3:175914409-175914431 ATGTTCTTAATGAGGAAACCAGG - Intergenic
971075769 4:23147401-23147423 ATGCTGGAAATAAGGAAACAAGG - Intergenic
971695552 4:29898512-29898534 ATGTGGTAAGTTAGGAAACAGGG - Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
975191861 4:71473261-71473283 ATTTTATAAGTGGGGAAACCTGG + Intronic
976168843 4:82283135-82283157 CTGAGTTAAGTGAGGAAACCTGG + Intergenic
976309920 4:83600995-83601017 AGGCTGTCAGCCAGGAAACCAGG + Intronic
977227639 4:94412180-94412202 TTGCAGTAACTGAGGAAAACAGG - Intergenic
977422454 4:96819185-96819207 ATTCTCTAAGTGGTGAAACCAGG + Intergenic
979597184 4:122547136-122547158 ACAGAGTAAGTGAGGAAACCAGG - Intergenic
981678556 4:147367418-147367440 ATGATGGAAGCCAGGAAACCAGG + Intergenic
982496487 4:156100145-156100167 ATTCTGTACATGAGGAAACGTGG + Intergenic
983095537 4:163557192-163557214 ATGCTGTAAATGAGGAAATTTGG - Intronic
983129114 4:163992923-163992945 CTGGTGAAAGGGAGGAAACCTGG + Intronic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
986499391 5:8383203-8383225 AGCCTGTAAGTGTGGAAGCCAGG - Intergenic
986958439 5:13184930-13184952 TTGCTGTTAGTGAGGAATCTGGG + Intergenic
988594935 5:32582664-32582686 ATGCTGTAGCTGAGAAAACGGGG + Intronic
991329203 5:65474715-65474737 CTGCTGTATGCGGGGAAACCAGG - Intronic
994264325 5:97696963-97696985 ATGCTGTAAGGGAGAATAACAGG + Intergenic
995738132 5:115325159-115325181 ATGCTCTAATTGTGGAATCCCGG - Intergenic
996531540 5:124532674-124532696 AGGCTGAAAGTGTGTAAACCTGG - Intergenic
996637091 5:125705581-125705603 AAGCTGTAAGGGAGGAAATGAGG + Intergenic
997744415 5:136286639-136286661 ATTCTGTAGGTCAGGAAATCAGG - Intronic
997943629 5:138180271-138180293 ATGCTGTAACTGAGAAACCCTGG - Intronic
1002430769 5:179202716-179202738 ATGGTGTGAGTAAGGAAACACGG - Intronic
1003826658 6:9960240-9960262 CAGCTGTCAGTTAGGAAACCAGG + Intronic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1008492820 6:52103683-52103705 ATGGTGTTAGAGAGGAATCCTGG - Intergenic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1015364337 6:132380285-132380307 AGGCTCAATGTGAGGAAACCTGG - Intronic
1015907980 6:138137359-138137381 ATTCAGAAAGTGAGGATACCTGG + Intergenic
1020452732 7:8338472-8338494 ATGCTGTTTGTATGGAAACCAGG + Intergenic
1021620208 7:22543775-22543797 ATGCTGTGAGTCAGGCAACCTGG + Intronic
1022855554 7:34310226-34310248 ATTCTTTAAGTGAGGAATACAGG + Intergenic
1023623993 7:42098408-42098430 ATCCTATAGGTGAGGAAACTGGG - Intronic
1024788987 7:52940940-52940962 ATGCTGTATGTGAGGACTGCTGG + Intergenic
1026143269 7:67724076-67724098 TTCATGCAAGTGAGGAAACCAGG + Intergenic
1028121114 7:87058071-87058093 ATGTTGTAATTGGGGAAATCAGG - Intronic
1030284213 7:107808979-107809001 ATGCAGTCAGTGAAGAAGCCAGG - Intergenic
1030418878 7:109281836-109281858 ATGCTTTATGTGAGCAAATCAGG + Intergenic
1031308146 7:120160088-120160110 ATACTGTAATTGAGGACACATGG - Intergenic
1032846428 7:135755466-135755488 AGGCTGTAAGTGAGGTAATTGGG + Intergenic
1033480942 7:141739718-141739740 ATGTGGTAAGTGAGGAAAAATGG - Intronic
1034198363 7:149265009-149265031 AGGCTGGAAGTGGGGAAATCAGG + Intronic
1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG + Intronic
1034613777 7:152396748-152396770 ATGTTGTTAGTGAGGATGCCAGG + Intronic
1035142842 7:156781417-156781439 ATGCAGGAAATGTGGAAACCTGG - Intronic
1036054975 8:5241602-5241624 ATGGTGTAAGGGAGGAGTCCAGG - Intergenic
1036740891 8:11360801-11360823 TTGCTGTAAGTGGGGAAAATTGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041547365 8:59060795-59060817 ATGTTACAAATGAGGAAACCAGG + Intronic
1042656594 8:71105008-71105030 AAGCTGTAAATGATGAAGCCTGG - Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1045227769 8:100266829-100266851 AGGTTTTAAGTGAGTAAACCTGG - Intronic
1047760773 8:127952493-127952515 ATGAAATGAGTGAGGAAACCAGG - Intergenic
1048799385 8:138182056-138182078 GTGCTGTGAGTGAGGGAACAAGG - Intronic
1050102043 9:2129455-2129477 ATGCAGTCTGGGAGGAAACCTGG + Intronic
1051665820 9:19466035-19466057 AGGCTGGAAGTCAGGACACCTGG - Intergenic
1053589208 9:39493950-39493972 AGGCAGTAAGTGAGGAAATAAGG + Intergenic
1054577090 9:66871345-66871367 AGGCAGTAAGTGAGGAAATAAGG - Intronic
1056109227 9:83378069-83378091 ATGCTGTAAGTGAGGAAACCAGG - Intronic
1057616513 9:96595680-96595702 ATGCTGTATGAAAAGAAACCAGG + Intronic
1058114614 9:101070646-101070668 ATGATTTAAACGAGGAAACCAGG - Intronic
1059482966 9:114606313-114606335 ATGCTGTTTGTCAGGAAACCGGG - Intergenic
1059761558 9:117342612-117342634 ACCTTGTAGGTGAGGAAACCAGG - Intronic
1060340002 9:122767255-122767277 ATGCAGCAAGTGAGCAAGCCAGG + Intergenic
1060445759 9:123686139-123686161 ATGCAGTAAGGGGGGAAACTAGG + Intronic
1061598671 9:131650240-131650262 CTCCTGGAAGAGAGGAAACCTGG + Exonic
1191989603 X:67019935-67019957 ATGTAGTGAGTGAGGAAACTGGG - Intergenic
1194767590 X:97860161-97860183 ATTTTGTCAGTGAGGAAACTGGG - Intergenic
1194924184 X:99804899-99804921 ATTCTGTAAGTCAGGAATTCTGG + Intergenic
1195120748 X:101749230-101749252 ATGCTGTAAGTGAAGCTATCTGG + Intergenic
1195522975 X:105851822-105851844 ATCCTGTAAGAGAGAAAAGCAGG - Intronic
1197400481 X:125983222-125983244 ATGCATTATGTGAGGAGACCAGG + Intergenic
1198406564 X:136318648-136318670 ATGCTATGAGTGAGAAAAGCAGG + Intronic
1199735126 X:150678947-150678969 ATGCTGAATGTGAGGAGAACAGG + Intergenic
1200323948 X:155217826-155217848 AGGATGTAAGTGAGGTATCCAGG + Intronic
1201051003 Y:9935390-9935412 ATGTTGTAAGTGTGGGAATCTGG + Intergenic
1201682137 Y:16658360-16658382 TTTCTGTAAGTCAGGAAAACTGG + Intergenic