ID: 1056110080

View in Genome Browser
Species Human (GRCh38)
Location 9:83386402-83386424
Sequence TAGAGTAAAGGAAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 586}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056110080_1056110086 -9 Left 1056110080 9:83386402-83386424 CCCCCATCCTTTCCTTTACTCTA 0: 1
1: 0
2: 8
3: 41
4: 586
Right 1056110086 9:83386416-83386438 TTTACTCTACTACCCAAGTCTGG No data
1056110080_1056110087 -8 Left 1056110080 9:83386402-83386424 CCCCCATCCTTTCCTTTACTCTA 0: 1
1: 0
2: 8
3: 41
4: 586
Right 1056110087 9:83386417-83386439 TTACTCTACTACCCAAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056110080 Original CRISPR TAGAGTAAAGGAAAGGATGG GGG (reversed) Intronic
901673507 1:10869345-10869367 TAGACCAAAGGATATGATGGGGG + Intergenic
902938524 1:19782595-19782617 TAGAGGGAAGGAAAAGAAGGAGG - Intronic
903111972 1:21143321-21143343 GAGAGCAAAGGAAAGGAAGAAGG + Intronic
903388101 1:22942965-22942987 GAGAGCAAAGGAAAATATGGGGG + Intergenic
903976657 1:27154662-27154684 TAGTGCAAAGGAAAGGAAGAAGG + Exonic
904334628 1:29788748-29788770 CAGGGGATAGGAAAGGATGGAGG - Intergenic
905932445 1:41799024-41799046 TGCAGTAAAGAAAAGGAGGGAGG - Intronic
906086623 1:43140977-43140999 TATAGAGAAAGAAAGGATGGTGG + Intergenic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
907022286 1:51080000-51080022 GAGAGAAAAGGAAAGGAAAGGGG - Intergenic
907279115 1:53333943-53333965 CAGAGGAAAGGAGAGGATGAAGG + Intergenic
907516078 1:54994292-54994314 TAGAGGAGAGGAAGGGAGGGAGG - Intergenic
907784939 1:57602504-57602526 GAGAGTTAATGAAAGGATGAGGG + Intronic
907871794 1:58450273-58450295 TTGAGTCAAGGACACGATGGGGG - Intronic
908629315 1:66084939-66084961 TAGAGTTAGGGCAGGGATGGTGG + Intronic
909989298 1:82202744-82202766 CAGAGTAATGGAAAGAAGGGAGG + Intergenic
910203038 1:84719535-84719557 CAGAGGAAAGGAACTGATGGGGG + Intergenic
910204748 1:84738096-84738118 AAGAGAAAAGGAAAGCATAGAGG - Intergenic
910388043 1:86705357-86705379 GAGACGAAAGGAAAGGGTGGGGG - Intronic
910390604 1:86739248-86739270 TAGAGAAAAGGAGAGGATCAAGG + Intronic
910820068 1:91336431-91336453 AAGAAGAAAGGACAGGATGGAGG - Intronic
911140741 1:94499593-94499615 TGGAGAAAAGCAAAGAATGGCGG + Exonic
911687083 1:100789965-100789987 GCGAGTGAAGGAAAGGATGGTGG - Intergenic
911971815 1:104448365-104448387 GAGAGGAAAGGAGAGGAGGGAGG - Intergenic
912156682 1:106929791-106929813 GGCAGTAAAGGAGAGGATGGCGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912603907 1:110967944-110967966 GAGAGTAAAGAAAATGTTGGAGG + Intergenic
913142542 1:115955658-115955680 GAGAGTGAAGGAGAGAATGGAGG + Intergenic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
913697029 1:121336529-121336551 TAGAGAAAAGGAAGGGAAGGAGG - Intronic
913940352 1:125097994-125098016 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
913982512 1:143534484-143534506 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
914038122 1:144022597-144022619 GAGAGTGAAGGAAGTGATGGAGG - Intergenic
914140530 1:144943515-144943537 TAGAGAAAAGGAAGGGAGGGAGG + Intronic
914362276 1:146945107-146945129 AAGAAGAAAGGAAAGAATGGAGG - Intronic
914386558 1:147174816-147174838 TAGAGGAAAGGAAAAGAAGGAGG + Intergenic
914424121 1:147558949-147558971 TAGAGTAAAGGAGATGAAGTAGG - Intronic
914489399 1:148141971-148141993 AAGAAGAAAGGAAAGAATGGAGG + Intronic
915264549 1:154707516-154707538 TAGACAAAAGGAAAGGAGAGAGG + Exonic
915306759 1:154984221-154984243 TAGAGTAATTGAAAGAATGAGGG - Intronic
915587097 1:156849714-156849736 GAGAGTCGAGGGAAGGATGGGGG - Intronic
915755058 1:158251540-158251562 TAGAAGAATGGAAAGCATGGAGG - Intergenic
916528264 1:165631573-165631595 GAGAGGAAAGGAAGGAATGGAGG - Intronic
916949752 1:169767587-169767609 GAGAGGAAAGGAAACGAGGGAGG + Intronic
917043379 1:170830876-170830898 AAGAAGAAAAGAAAGGATGGAGG - Intergenic
918392907 1:184084884-184084906 AAAGGTAAAGGAAAAGATGGGGG + Intergenic
918761133 1:188410258-188410280 TGGAGGAAAGGAAAGGGTGGAGG + Intergenic
918833947 1:189435441-189435463 TAGAGTAAAGGAAAGAGGGAAGG + Intergenic
919669120 1:200322611-200322633 CAAAGAAAAGGAAAGGAAGGTGG - Intergenic
919912534 1:202120604-202120626 AAGAGAAAAGGAAAGGAAGTTGG - Intergenic
920205285 1:204286821-204286843 TAGAGTATAGGAGAGGAACGGGG - Intronic
920484360 1:206354866-206354888 TAGAGAAAAGGAAGGGAGGGAGG - Intronic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921553623 1:216569242-216569264 GAAAGGAAAGGAAAGGAGGGAGG + Intronic
921684457 1:218074228-218074250 TGGAGGACAGGAAAGGATGGAGG - Intergenic
923183901 1:231550748-231550770 GAGACTAAAGGAATGGTTGGGGG + Intronic
923548851 1:234945378-234945400 TAGAAGAAAGGAATGGAAGGTGG + Intergenic
924570774 1:245235659-245235681 AAGAGGGAAGGAAAGGAGGGAGG + Intronic
924714441 1:246559617-246559639 TAGAGGAAGGGAAAGACTGGGGG + Intronic
924824407 1:247524258-247524280 GAGAGTAAGGGAAAGAGTGGTGG - Intronic
1063698042 10:8356615-8356637 GAGAGGAGAGGAAAGGAGGGAGG - Intergenic
1063802956 10:9602431-9602453 TTGAGTAAAGTAAGGGAGGGCGG + Intergenic
1064709452 10:18108988-18109010 CAGAGTCAAGGAAAGGAAGAGGG - Intergenic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065252535 10:23830971-23830993 TGCAGTAAAGGAAAGGATTCGGG + Intronic
1065699783 10:28413850-28413872 TAGAATAAAAGAAAGGAGGCCGG + Intergenic
1065899495 10:30192455-30192477 TGGTGTAAAGGGGAGGATGGGGG - Intergenic
1066951420 10:42121826-42121848 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1067257649 10:44659972-44659994 AAGAATGAAGGAAAGGAAGGAGG - Intergenic
1067973341 10:50995647-50995669 AAGAGTAAGGGAAAGGATTAAGG - Intronic
1068343133 10:55735032-55735054 TTGAGGAAAGAAAAGGAAGGAGG - Intergenic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068383254 10:56288190-56288212 CAGAGTAAAAGACAGGTTGGAGG - Intergenic
1069135144 10:64754535-64754557 TAGAATAAAGTAATGGATAGAGG + Intergenic
1069752974 10:70756566-70756588 AAGAACAAAGGAAAGGTTGGGGG + Intronic
1069760092 10:70804124-70804146 AAGAGAAAAGGAAAGAATGGAGG + Intergenic
1070336972 10:75464471-75464493 TAGAGGAAAGGATGAGATGGAGG + Intronic
1070777468 10:79118213-79118235 TCGAATAGAGGAAGGGATGGGGG + Intronic
1070894541 10:79972122-79972144 TAGTATAATGCAAAGGATGGGGG + Intronic
1072492717 10:95923383-95923405 TAGAGAAAAGGAAAGTTTTGAGG - Intronic
1072532787 10:96335379-96335401 TTGAGTGAATGAAAGGATGGAGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073553873 10:104428994-104429016 CAGAGAAAAGGAAAGGATCAAGG + Intronic
1073567279 10:104545986-104546008 GAGGGACAAGGAAAGGATGGAGG - Intergenic
1073786876 10:106899340-106899362 AAGAGTAAGGGAAGGAATGGTGG + Intronic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1074484307 10:113858205-113858227 GAAAGAAAAGGAAGGGATGGGGG - Intronic
1074724120 10:116289882-116289904 GAGAGAAAAGGAAGGGAGGGAGG - Intergenic
1075468538 10:122670725-122670747 TAAAGTAAAAGTAAGGGTGGTGG + Intergenic
1077677477 11:4208423-4208445 TACATCAAAGGAATGGATGGTGG - Intergenic
1079206188 11:18416828-18416850 GAGAGGAAAGGAAAGGATGGAGG - Intronic
1079713242 11:23712789-23712811 AAGGGGAGAGGAAAGGATGGGGG - Intergenic
1080811516 11:35709028-35709050 CTGAGTAAAGGAAGGGATTGGGG - Intronic
1081030650 11:38077482-38077504 TAGGGGGAAGGACAGGATGGGGG + Intergenic
1081693653 11:45094772-45094794 TAGAGGGAAGGAAGGGAGGGAGG + Intergenic
1082177544 11:49078686-49078708 AAGAAAGAAGGAAAGGATGGGGG - Intergenic
1082196914 11:49317236-49317258 TACAGAAAAGGAAATGTTGGAGG + Intergenic
1082847541 11:57738776-57738798 TAGTGCAAAGGGAGGGATGGTGG + Intronic
1084470464 11:69356359-69356381 GAGAGGGAAGGAAAGGAGGGAGG + Intronic
1084638192 11:70407392-70407414 AAGAGGAAAGCAAAGGCTGGCGG - Intronic
1085095330 11:73755781-73755803 GGGAGAAAAGGAAAGGAAGGGGG + Intronic
1085859948 11:80221551-80221573 TAGAGAAAAGGAAAGACAGGAGG + Intergenic
1086211695 11:84328322-84328344 AAGAAGAAAGGAAAGGAAGGAGG + Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086449294 11:86900209-86900231 TAGAGGAGAGGAAAGCATTGAGG - Intronic
1086658913 11:89390952-89390974 TACAGAAAAGGAAATGTTGGAGG - Intronic
1086934845 11:92733628-92733650 TTAAGTAAATGAAAGCATGGTGG + Intronic
1087279825 11:96197879-96197901 AAGTGTAAAAGTAAGGATGGAGG + Intronic
1087612480 11:100451533-100451555 AAGAGTCAAGGAAAGGGTAGAGG + Intergenic
1088475191 11:110229923-110229945 TACATCAAAGGAATGGATGGTGG - Intronic
1090077017 11:123585960-123585982 GAGATTAAAGGAAAGGAAAGGGG - Intronic
1090583091 11:128181153-128181175 TAGAAAATAGAAAAGGATGGGGG + Intergenic
1090923502 11:131229607-131229629 TAAAGAAAGGGAAAGGATTGGGG + Intergenic
1091214017 11:133889085-133889107 CAGAGACAAAGAAAGGATGGAGG + Intergenic
1091340256 11:134806529-134806551 TAGAGAGAAGGAAAGGAGGGGGG + Intergenic
1092395785 12:8124636-8124658 TAGAGTACAAGAAACTATGGGGG + Intronic
1092449986 12:8593236-8593258 GAGAGGAGAGGAGAGGATGGGGG + Intergenic
1092673473 12:10889769-10889791 TAGCATAAAGAAAATGATGGAGG - Intronic
1092759921 12:11800559-11800581 CAGAGTAAAAGAAGGGATGCGGG - Intronic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1093082736 12:14831883-14831905 TAGAGTAACTGAAAGGATGGAGG - Intronic
1093331930 12:17854240-17854262 TAGTGTAAAGAAAATGATTGTGG + Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1096190729 12:49616754-49616776 TTGAGTAAAGGAAATGATGATGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097767997 12:63547597-63547619 TAGAGAGAAGGAAAGGAGGTTGG + Intergenic
1097784357 12:63742663-63742685 TAGAGAGAAGGAAAGGAGGTTGG + Intergenic
1097884998 12:64720184-64720206 TAGAGGACATGAAAGAATGGAGG + Intronic
1097924324 12:65110881-65110903 CAGAGTGATGGAAAGAATGGTGG + Intronic
1097969371 12:65616110-65616132 GAGAGGAAAGGAAAGAAAGGCGG - Intergenic
1098474936 12:70889798-70889820 TAAAGGAAAGGAGAAGATGGAGG - Intronic
1098566689 12:71945224-71945246 TGGAGTAGAGGAAAGAATGATGG - Intronic
1098734435 12:74081427-74081449 TAGGGTTAAGGAAAGAATGAGGG - Intergenic
1098997616 12:77139549-77139571 AAGAGGAAAGGAAAGGAGGGTGG - Intergenic
1099131135 12:78833133-78833155 GTGAGTATAGGAAATGATGGTGG - Intergenic
1099812137 12:87596761-87596783 TAAAGTAAGGGAAAGGAGAGGGG + Intergenic
1100411629 12:94325071-94325093 GAGACTGAAGGAAAGGAGGGAGG - Intronic
1100473320 12:94913274-94913296 TAGAGGAGGGCAAAGGATGGTGG - Intronic
1100601078 12:96111867-96111889 AAGAAAAAAGGAAAGGAGGGAGG - Intergenic
1100643287 12:96503268-96503290 AAGGGGAAAGGAAAGGAAGGGGG - Intronic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1101381094 12:104214767-104214789 TAGAGTAAAGTAAAGGGTGGGGG + Intergenic
1102603383 12:114050368-114050390 TAGAACAATGGAAAGGATGTGGG - Intergenic
1102717458 12:114986544-114986566 AAGAGGAGAGGAAAGGAAGGAGG - Intergenic
1102720310 12:115010310-115010332 TTGAGAAGAGGATAGGATGGTGG - Intergenic
1102833717 12:116032956-116032978 AAGAATATAGGAAAGGGTGGCGG + Intronic
1102991980 12:117322251-117322273 AAGAGGAAGGGAAAGGAGGGAGG - Intronic
1103314494 12:120041604-120041626 CAGAGGAAAGGAATGGAGGGCGG + Intronic
1103729521 12:123017931-123017953 TGAAGGAAAGGAAAGGAGGGAGG - Intronic
1103921405 12:124401221-124401243 AAAAGAAAAAGAAAGGATGGGGG + Intronic
1106358919 13:29012128-29012150 TAGACTCACGGAATGGATGGAGG - Intronic
1106385281 13:29278884-29278906 GAGAAGAAAGGAAAGGATTGAGG - Intronic
1107041298 13:35950898-35950920 GGGAGTAAAGGAGAGGAGGGTGG - Intronic
1107628725 13:42319850-42319872 TAATGTCAATGAAAGGATGGGGG - Exonic
1107971217 13:45644645-45644667 TAGATCAAAGGAAATGAGGGAGG + Intergenic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1109496029 13:63173086-63173108 GAAAGAAAAGGAAAGGAGGGAGG - Intergenic
1110582768 13:77151224-77151246 TAAAGTACAGGAAAAGATAGTGG + Intronic
1110776784 13:79416924-79416946 AAGAGAAAAGGAAAGAATGGTGG - Intergenic
1111048375 13:82846621-82846643 GAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1111073061 13:83195071-83195093 AAGGGGAAAGGAAGGGATGGTGG + Intergenic
1111444061 13:88322090-88322112 TAGAGTTTAGGAATGGCTGGGGG - Intergenic
1111727419 13:92030347-92030369 GAAAGAAGAGGAAAGGATGGTGG - Intronic
1112422651 13:99267036-99267058 TACAGGAAAGGAAGGGAGGGAGG - Intronic
1112636055 13:101219308-101219330 TAGGGTAAGGGGAATGATGGAGG + Intronic
1112749213 13:102565076-102565098 TAGAGCCAAGGAAGAGATGGGGG + Intergenic
1112820285 13:103326362-103326384 GAGAGAAAAAGAAAAGATGGTGG - Intergenic
1113606699 13:111612998-111613020 TAGAGAAAAGCACAGGGTGGCGG + Intronic
1114562751 14:23605066-23605088 TAGAGGAAAGGAATGAAGGGAGG - Intergenic
1114678592 14:24462953-24462975 TTGAGTAAATGAAAGAATGGTGG + Intergenic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117015421 14:51512787-51512809 TAGAGGAAAAGCAAGGATTGGGG + Intronic
1117648725 14:57880015-57880037 GAAAGGAAAGGAAAGGAGGGAGG + Intronic
1117721354 14:58631889-58631911 TGGGCTAAGGGAAAGGATGGGGG - Intergenic
1118372427 14:65148961-65148983 TAGATGAAATGAAAGGGTGGAGG - Intergenic
1120337667 14:83178923-83178945 GAGAGTGAAGGGCAGGATGGGGG + Intergenic
1121050140 14:90815101-90815123 AAGAGTGAATGAATGGATGGCGG - Intronic
1121246312 14:92463318-92463340 AAGAGGAAAGGACAGGAAGGCGG - Intronic
1121579762 14:95020333-95020355 AAGAGCAAAGGAAAGAAAGGTGG - Intergenic
1121934090 14:98000740-98000762 AAGAAGAAAGGAAAGGAAGGAGG + Intergenic
1121950335 14:98166096-98166118 TGGTGTAGAGGACAGGATGGGGG + Intergenic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1122674771 14:103402772-103402794 AAGAACAAAGTAAAGGATGGAGG + Intronic
1123395760 15:19933459-19933481 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1124420459 15:29516590-29516612 GAGAGCAAAGGAGGGGATGGGGG + Intronic
1125909941 15:43427458-43427480 TACAGAAAAGGAAAGCATGATGG + Intronic
1127537570 15:59904332-59904354 AAGAGATAAAGAAAGGATGGGGG + Intergenic
1128214139 15:65922695-65922717 TAGAGGGAAGGAAGAGATGGGGG + Intronic
1128671334 15:69576628-69576650 TGGGGAAAGGGAAAGGATGGAGG + Intergenic
1129532093 15:76276088-76276110 TAGAGAGAAGGAAATGATAGAGG - Intronic
1129915287 15:79264790-79264812 TTGAAAAAAGGAAAGGAGGGGGG + Intergenic
1129917800 15:79289701-79289723 TAGGATAAAGGAAAAGATGGAGG - Intergenic
1129942578 15:79511101-79511123 TGGAGAAAAGGAAAGAATCGAGG - Intergenic
1132304793 15:100803300-100803322 AAGAGAACAGGACAGGATGGTGG + Intergenic
1133141837 16:3750812-3750834 TTCAGTAACTGAAAGGATGGAGG + Intronic
1133191316 16:4135662-4135684 TAGAGGATAGGGATGGATGGAGG + Intergenic
1133683878 16:8147447-8147469 CAGAAAAACGGAAAGGATGGGGG + Intergenic
1133744490 16:8676007-8676029 TAGACTAAGGGACAGGATGTTGG + Intronic
1134275333 16:12770869-12770891 GAAAGGAAAGGAAAGGAAGGGGG + Intronic
1134318252 16:13139498-13139520 TAAAGTAAAGGAAGGGATGAAGG - Intronic
1134509516 16:14834776-14834798 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134697221 16:16233592-16233614 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134974625 16:18561082-18561104 AAGAGGAAAGGGATGGATGGAGG - Intronic
1135758578 16:25118268-25118290 TAGATGAACTGAAAGGATGGCGG - Intronic
1135794842 16:25431966-25431988 TAGAGAAAAGGAAAGAAGGAAGG - Intergenic
1136769399 16:32822236-32822258 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1136798706 16:33048902-33048924 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1136935618 16:34461171-34461193 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1136956419 16:34791849-34791871 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1136964200 16:34887399-34887421 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1136968346 16:34942091-34942113 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1137088815 16:36162645-36162667 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1137093344 16:36221871-36221893 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1137837483 16:51606919-51606941 TAGAGAATAGGATAGAATGGTGG - Intergenic
1138063538 16:53916360-53916382 TAGAATAAAAGAAACGATTGTGG - Intronic
1138381852 16:56608248-56608270 TCGAGTACAGGACAGGAGGGAGG + Exonic
1139317469 16:66086125-66086147 TACAAGAAAGGAAGGGATGGAGG + Intergenic
1140563288 16:76009489-76009511 TAGAATAAATGAAAGAATAGGGG + Intergenic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1140970831 16:80010625-80010647 GTGAATAAAGGAATGGATGGTGG - Intergenic
1141740766 16:85891104-85891126 TAGAGTAAAGAAACAGATTGCGG + Intergenic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1203071815 16_KI270728v1_random:1084341-1084363 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1142501407 17:335243-335265 GAGAATAAAGGAAATGATGCAGG + Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144189338 17:12829829-12829851 TAAAATAAAGCAGAGGATGGGGG - Intronic
1144542419 17:16157242-16157264 TCCAGTAAAGGAAGGGAAGGAGG - Intronic
1144587370 17:16495380-16495402 GAGAGAAAAGGAAAGAAGGGAGG - Intergenic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1148564096 17:48623154-48623176 TAGAATCAAAGAAAGGAAGGGGG + Intronic
1149833346 17:59890797-59890819 CAGAGTAAAGGAGAGGACTGTGG + Intronic
1149981779 17:61316620-61316642 TAAAATAAAGGAAAGGTTAGAGG + Intronic
1150253561 17:63724794-63724816 CACAGTAAAGGAAAGGATAGTGG - Intronic
1150586341 17:66521942-66521964 TTGAGTGAAGGAAAGAATTGAGG + Intronic
1151327631 17:73388836-73388858 GAAAGAAAAGGAAAGGAGGGGGG - Intronic
1152297467 17:79476432-79476454 TAGGGCAAAGAAAAGGATAGAGG + Intronic
1152664097 17:81557413-81557435 CAGAGTAAGGGAAATGCTGGTGG + Exonic
1203183896 17_KI270729v1_random:93414-93436 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1153515624 18:5898053-5898075 TAGAGCAAATGAAAGGTTGCAGG - Intergenic
1156752277 18:40473720-40473742 AAAAATAAAGGAAAGGATGAGGG + Intergenic
1157025991 18:43844332-43844354 TCGAGTAATGAAAAGGATTGAGG - Intergenic
1157099983 18:44720650-44720672 GAGAGTACAGGGAGGGATGGAGG + Intronic
1157757013 18:50227879-50227901 AAGAGTAAGGGAAGGGATGGAGG - Intronic
1158102951 18:53851374-53851396 AAGAGAGAAGGAAAGGGTGGGGG - Intergenic
1158816523 18:61103952-61103974 TAGAGAAAAGGATAAGATGATGG + Intergenic
1159094402 18:63886221-63886243 GTGAGTGAAGGAAAGGGTGGTGG + Intronic
1159356054 18:67338221-67338243 AAGAAGAAAGGAAAGAATGGAGG - Intergenic
1159446799 18:68550899-68550921 CATAGTAAATGAAAGAATGGAGG + Intergenic
1160308259 18:77761696-77761718 AAGAGTAAAGTAAAAGAGGGAGG - Intergenic
1161280366 19:3442337-3442359 CAGAGGAGAGGAATGGATGGGGG - Intronic
1162780264 19:13002962-13002984 TGGAGGAAAGGACAGCATGGAGG + Intronic
1162886331 19:13700191-13700213 TAGGATACAGGAAAGGATGAGGG - Intergenic
1163066564 19:14800917-14800939 GAGAGGAAAGGACAGGCTGGTGG - Intronic
1163226748 19:15967259-15967281 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1164887871 19:31798677-31798699 CTGAGGACAGGAAAGGATGGAGG - Intergenic
1166299536 19:41906200-41906222 TAGAATCAAGCAAGGGATGGTGG - Intronic
1167103603 19:47418599-47418621 TAGAGCGAAGGGAAGGACGGAGG + Intronic
1168146425 19:54422032-54422054 TTGAGTAAGGGAAGGGATTGGGG - Intronic
1168155219 19:54470411-54470433 GAGAGAGAAGGAAAGGAGGGAGG + Intronic
1168330632 19:55565812-55565834 TAGATGAATGGAAAGGAAGGGGG + Intergenic
1202672023 1_KI270709v1_random:63963-63985 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1202682370 1_KI270712v1_random:18784-18806 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
925030171 2:644225-644247 TAGAGTGAATGAAGGTATGGAGG + Intergenic
925030174 2:644263-644285 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030180 2:644340-644362 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030184 2:644379-644401 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925030190 2:644418-644440 TAGAGTGAATGAAGGGCTGGAGG + Intergenic
925030194 2:644457-644479 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925030200 2:644496-644518 TAGAGTGAATGAAGGGCTGGAGG + Intergenic
925152551 2:1625214-1625236 TCGAGTTAAGGTAAGGATGGTGG + Intergenic
925466716 2:4112486-4112508 GGGAGTTCAGGAAAGGATGGAGG - Intergenic
925869715 2:8259224-8259246 TTGAGAAAAGGAAAGAAAGGGGG - Intergenic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
926193934 2:10749913-10749935 TACAGTAAATGAAAGGAATGAGG + Intronic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
927059426 2:19401604-19401626 TAGAGTATAGGAAAGGATTCAGG + Intergenic
928164804 2:28962840-28962862 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
928228004 2:29470914-29470936 AAGGATAAAAGAAAGGATGGTGG + Intronic
928662527 2:33517692-33517714 TAGAAAATAGGTAAGGATGGAGG + Intronic
928878363 2:36067769-36067791 TAAAGTAATGGAAATGAAGGGGG + Intergenic
928956871 2:36878269-36878291 TAGTGAAAAGGAAAGGACAGTGG - Intronic
930048811 2:47197641-47197663 TAGATTTTAGGAAATGATGGAGG - Intergenic
930102872 2:47616629-47616651 AAGAGTAAAAGAGAGGGTGGTGG + Intergenic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
930219754 2:48734584-48734606 TGAAGGAAAGGAAAGGAAGGAGG - Intronic
930258946 2:49123002-49123024 AAGGATAAAGGAAAGGAGGGAGG - Intronic
930430010 2:51263882-51263904 TAAAGTAAAGGAAGGAAAGGAGG - Intergenic
931192476 2:60018245-60018267 TATACTAAAGGAAAGTATGAAGG - Intergenic
931773399 2:65518663-65518685 AGGAGGTAAGGAAAGGATGGAGG - Intergenic
932464048 2:71902028-71902050 AAGAGTGAAGGAAGGGAGGGAGG - Intergenic
934303477 2:91799026-91799048 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
934329782 2:92053730-92053752 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
934467999 2:94283636-94283658 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
937021509 2:118661110-118661132 AAGAGAAAAGGAAAGGAAGAGGG - Intergenic
937062780 2:118992703-118992725 GAGAGAAAAGGAAAGGAAGAAGG - Intronic
937371581 2:121301410-121301432 GAAAGGAAAGGAAAGGAAGGAGG + Intergenic
937688530 2:124725482-124725504 GAGAGGAGAGGAAAGGAAGGGGG - Intronic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
938677056 2:133647522-133647544 GAAAGGAAAGGAAAGGAGGGAGG + Intergenic
938742726 2:134248238-134248260 TAGATGGAAGGACAGGATGGTGG - Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939299738 2:140320073-140320095 TAGATTAAATGGAAGGAGGGAGG - Intronic
939308398 2:140438806-140438828 TAGATTAGATGAAAGGATGCAGG + Intronic
939384090 2:141474094-141474116 GAGAGGAAAGGAAGGGACGGAGG - Intronic
939542357 2:143509681-143509703 TAAAGGAAAAGAAAAGATGGTGG + Intronic
939644094 2:144675226-144675248 TAGAATAAAGGAAGGAAGGGAGG - Intergenic
939794730 2:146628703-146628725 AAGAGTTAAGGAAAGGAAAGAGG + Intergenic
940514117 2:154658258-154658280 TAAAATAAAGAAAAGAATGGTGG - Intergenic
940982207 2:160016455-160016477 AAGAGGAAAGGAAAGAAGGGGGG + Intronic
942216183 2:173720985-173721007 TTCAGGAAAGGAAAGGAGGGGGG + Intergenic
944058615 2:195548298-195548320 AAGAGGAAAGGAAAGGAAGAAGG + Intergenic
944104199 2:196061716-196061738 TGGAGAAAAAGAAAGAATGGGGG + Intronic
944116248 2:196190007-196190029 AAGAGTACAGCAAAGGAAGGAGG - Intergenic
944740959 2:202612232-202612254 TAGAGAAAGAGAAAGAATGGTGG + Intergenic
944965099 2:204922349-204922371 TACAGAAAAGGGAAGGATTGTGG + Intronic
944969837 2:204979294-204979316 TAGAGTAAAGGCTGGGATGAAGG + Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945189824 2:207175744-207175766 CACAGAAAAGGAAAGGATTGGGG - Intergenic
947103512 2:226646260-226646282 TAGATTAAAGGAAAGCAAGCAGG - Intergenic
947918407 2:233849345-233849367 TAGAAAAGAGGACAGGATGGGGG + Intronic
947998033 2:234544851-234544873 GAAAGGAAAGGAAAGGAGGGAGG + Intergenic
1169704084 20:8482955-8482977 TAGAGGTAAGGAAATGATGGTGG + Intronic
1171823770 20:29876880-29876902 TAGAGAAAGGGAAAGGGTGAGGG - Intergenic
1172006130 20:31820073-31820095 GAGAGGGAAGGAAAGGAGGGTGG + Intronic
1172012914 20:31856838-31856860 TAGAGGAGGGGACAGGATGGAGG + Intronic
1172479142 20:35260739-35260761 TTGAGCAACGGAAAGGAAGGGGG - Intronic
1172539902 20:35703453-35703475 TAGAATAAAGGAATTCATGGGGG + Intergenic
1172776731 20:37411767-37411789 GAAAGGAAAGGAAAGGAAGGGGG - Intergenic
1173710417 20:45150867-45150889 TACAGTAAAGGAAAGGAAGAAGG + Intergenic
1174127568 20:48318261-48318283 TAGAAGAATGGAAAAGATGGAGG + Intergenic
1174181330 20:48676778-48676800 AAAAGGAAAGGAAAGAATGGAGG - Intronic
1174642530 20:52056854-52056876 GGGAGTAAAGGAAGGGATGGTGG + Intronic
1176585871 21:8584692-8584714 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1176690375 21:9901386-9901408 TTCAGTAGAGGAAAGGATGAAGG + Intergenic
1176902543 21:14460836-14460858 TTGAGTTAAGGTAAGGGTGGTGG - Intergenic
1177635816 21:23785209-23785231 GAAAGGAAAGGAAAGGAAGGAGG + Intergenic
1178030922 21:28524968-28524990 GAAAGTAAAGGAAAGAATAGGGG - Intergenic
1178481084 21:32979589-32979611 AAGAGAAATGAAAAGGATGGAGG + Intergenic
1178525015 21:33320333-33320355 TAGAATAAAGGAGAGAAGGGAGG + Intergenic
1179156807 21:38858120-38858142 GAGAGTACAGGAAAGGAAGGAGG + Intergenic
1179162937 21:38912829-38912851 GAGAAGAAAGGAAAGGAAGGAGG + Intergenic
1179291226 21:40019980-40020002 GAAAATAAAGGAAAGAATGGAGG - Intronic
1179462423 21:41546357-41546379 TAGAAGAAAGGAAAGGAGGAAGG + Intergenic
1179556100 21:42177465-42177487 AAGGGTAAAGGAAAGGACGCAGG - Intergenic
1180118186 21:45725857-45725879 TGGAGGAAAGGAAGGGGTGGGGG + Intronic
1180268678 22:10561597-10561619 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1182039446 22:27224996-27225018 TAGAGCAAAGGACAGGAAAGCGG - Intergenic
1182256562 22:29043223-29043245 TAGAGAGAAAGAAAGGCTGGAGG - Intronic
1182680729 22:32077416-32077438 GAGAGTAGGGGGAAGGATGGAGG - Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1184903761 22:47464849-47464871 CAGAGTAAAGGAAAAGTAGGAGG - Intronic
949130603 3:495709-495731 TAGAATCAAGCAAAGGAGGGAGG + Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949843512 3:8347112-8347134 TAGAGAAAAGAAAAGTATTGTGG + Intergenic
950894157 3:16432881-16432903 TAAAGGAAAGGAAAGGAAAGAGG + Intronic
951235324 3:20228771-20228793 TATAGCATAGGAAAAGATGGTGG + Intergenic
951280626 3:20744739-20744761 AATTGTAAAGGAGAGGATGGAGG - Intergenic
952258358 3:31714751-31714773 ATGAGGAAAGGAAGGGATGGTGG - Intronic
953395738 3:42568234-42568256 AAGAGAAAAGGTAAGGAGGGAGG - Intronic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
956055576 3:65295140-65295162 CACAGTAAAGGAAGGGATGAGGG + Intergenic
956271659 3:67454319-67454341 CAGAGTAAAGGATAGGGTTGTGG + Intronic
956920550 3:73924120-73924142 TAGTCTGAAGGAAAGGGTGGAGG + Intergenic
956988259 3:74730174-74730196 GAGAGTTAAGGAAAGGAGGAAGG - Intergenic
957157706 3:76566708-76566730 TAGAGTGAGGGAAAGAAGGGTGG + Intronic
957805246 3:85139897-85139919 TGGAGTGAAGGGAAGGATGTAGG + Intronic
957936802 3:86954802-86954824 AAGAATAAAGGAAAGGAAGAAGG + Intronic
958115305 3:89208480-89208502 AAGAGAAAAAGAAAGGAGGGAGG + Intronic
958503114 3:94939586-94939608 AAGAGTAAAGGAAAGGAAGAAGG + Intergenic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959370705 3:105521792-105521814 GAAAGGAAAGGAAAGGAAGGTGG + Intronic
961074699 3:123971485-123971507 CAGAGGAGAGGAAAGGAAGGTGG - Intronic
961308982 3:125980993-125981015 CAGAGGAGAGGAAAGGAAGGTGG + Intronic
961442236 3:126959942-126959964 GAGAGTAAAGGAAAGGGGAGCGG + Intronic
962389902 3:134962680-134962702 AAAATTAAAGGAAAGGATGTGGG - Intronic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
962962699 3:140325724-140325746 TAGAGGAGAAGAAAGGAAGGAGG - Intronic
963219390 3:142790591-142790613 TAGAGAAAAGAAAAGGATCAGGG + Intronic
964433379 3:156627693-156627715 TAGAGTTAAGGAAAAGATTTAGG - Intergenic
965570671 3:170168824-170168846 TAGAGAAAAGAAAAGAATGCAGG + Intronic
966078159 3:175964411-175964433 AAAAGAAAAGGAAAGGAGGGAGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966690393 3:182735594-182735616 TATTGTAAAGGAAAAGATAGTGG + Intergenic
967061440 3:185876538-185876560 TAGAGGGAAGGAAAGGATAGAGG - Intergenic
967926246 3:194650561-194650583 TAGAGAAAAGGAAAGTATTTGGG + Intronic
969631697 4:8342848-8342870 TAGATTAGAGGGAAGCATGGAGG + Intergenic
970319812 4:14863830-14863852 CAGAATAAAGGAAAGAATGTTGG - Intergenic
970472043 4:16388739-16388761 TAGAGGAAAGCAGAGGCTGGGGG - Intergenic
970993581 4:22239608-22239630 AAGAGTAAAGGCAAGGCCGGTGG + Intergenic
971412132 4:26385003-26385025 GAGAGGAAAGGAAAGGGGGGAGG - Intronic
971423204 4:26492367-26492389 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971423253 4:26492661-26492683 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971902638 4:32681942-32681964 AAGAAGAAAGGAAAGGACGGAGG + Intergenic
972209610 4:36821795-36821817 TGGAGGAAAGGAGAGGAAGGGGG + Intergenic
972353071 4:38255086-38255108 AAGAATAAAGGAAGGGATGGAGG + Intergenic
972371603 4:38429456-38429478 AAGATGAAAAGAAAGGATGGTGG + Intergenic
972873768 4:43332115-43332137 TAGAGCAAAGGAGAGGATCTTGG + Intergenic
973210038 4:47605436-47605458 GGGAGTGAAGGAAGGGATGGAGG - Intronic
973328147 4:48884839-48884861 CAGAGTAAAAGAAAGAATAGAGG + Intergenic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
976081150 4:81356212-81356234 GGGAGGAAAGGAAAGGAGGGGGG + Intergenic
976085975 4:81407584-81407606 TGAAGGAAAGGAAAGGATAGAGG + Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
978093608 4:104747789-104747811 TGGAGTCAAGGTCAGGATGGTGG - Intergenic
978471105 4:109068406-109068428 AAGAGGAAAGGAAGGGAGGGAGG + Intronic
979286338 4:118929158-118929180 TGGGAAAAAGGAAAGGATGGAGG + Intronic
979348500 4:119618187-119618209 AAAAGTAAAGGAAATGATGCTGG + Intronic
979352678 4:119663617-119663639 AAGAGGAGAGGAAAGGAAGGAGG - Intergenic
979362472 4:119781117-119781139 TAGAGCAAATAAAAAGATGGGGG + Intergenic
979740814 4:124148321-124148343 TAGAGTAAAGGAAGGAATGAAGG - Intergenic
979959982 4:127007099-127007121 TAGAGTAAGGGAATGGATAGAGG + Intergenic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
981183252 4:141770120-141770142 TAGACAAAAGGAAAGAAGGGAGG - Intergenic
981330545 4:143503545-143503567 TAAAGACAAGGGAAGGATGGAGG - Intergenic
981360786 4:143843349-143843371 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981360794 4:143843381-143843403 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981563060 4:146067790-146067812 GAAAGGAAAGGAAAGGAGGGAGG - Intergenic
981689723 4:147494410-147494432 TTGAGTAAAAGAAGGGATGAAGG + Intronic
982262532 4:153507396-153507418 TAGAGAAAAAGCAAGCATGGGGG - Intronic
983939849 4:173527484-173527506 GAGAGGAAAGGATACGATGGGGG + Intronic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
985277339 4:188250698-188250720 AAGAGAAAAGCAAAGGATGCAGG + Intergenic
985751743 5:1682890-1682912 TAGTGTAAAGGTCAGGAAGGAGG + Intergenic
986108648 5:4687810-4687832 TAGAATAAAGGAAATTATCGGGG + Intergenic
986231477 5:5868191-5868213 GAGAGTGAAGGGATGGATGGGGG - Intergenic
987276923 5:16372532-16372554 TAAATGAAAGGAAAGGATCGAGG - Intergenic
987542175 5:19270107-19270129 ATCAATAAAGGAAAGGATGGAGG + Intergenic
988053885 5:26066802-26066824 TAGAGGAAAAGAAATGATGGGGG - Intergenic
988776894 5:34485169-34485191 TAGAGTGAATGAAGGGGTGGGGG - Intergenic
988914293 5:35876766-35876788 AAGAGTAAAGGAAATGATTGAGG + Exonic
989383462 5:40831799-40831821 TAGACTAAAGGCAATGATGTGGG - Exonic
990314890 5:54574663-54574685 TATGGTAATGGAAAGGAAGGGGG + Intergenic
990696456 5:58423087-58423109 CAGAGTTAATGAAAGGATTGTGG - Intergenic
990758704 5:59104649-59104671 TAGAAGAAAGGAAAGAAAGGGGG + Intronic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
993050413 5:82920000-82920022 CAGGGTAAAGGAAAGGAAAGGGG - Intergenic
994683654 5:102922269-102922291 TATAGTTAAGGAATGGAAGGTGG + Intronic
994731631 5:103498681-103498703 AAGGGAAAAGGAAAGGAGGGAGG + Intergenic
995024169 5:107399350-107399372 GAAAGGAAAGGAAAGGAAGGAGG + Intronic
997177036 5:131789844-131789866 TAGAGAAGTGGAAAGGACGGAGG - Intronic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
998249645 5:140543345-140543367 TTGCCTAAAGGAGAGGATGGAGG - Intronic
998338342 5:141394219-141394241 TGCAGTCAAGGAAAAGATGGAGG - Exonic
998524399 5:142829088-142829110 TTGAGTCAGGGAAAGGCTGGTGG + Intronic
998949316 5:147375973-147375995 TAGCCTAAATGAATGGATGGAGG - Intronic
999039475 5:148391250-148391272 TAGAATAATGGAAAGACTGGTGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999495189 5:152089895-152089917 TAGAGTGAAAGAAAAGATGCAGG - Intergenic
999527426 5:152422619-152422641 TAGAATAAAAGAAAGGTAGGTGG + Intronic
999558354 5:152770671-152770693 AAAAGGAAAGGGAAGGATGGAGG + Intergenic
1000749459 5:165075367-165075389 GAGAGTAAGGAAAAGCATGGTGG - Intergenic
1000815029 5:165910088-165910110 TAGGGGAAAGGAAAAGCTGGAGG + Intergenic
1001508108 5:172296528-172296550 GAGAGAAAAGGAAAGGATTAGGG + Intergenic
1002497181 5:179623387-179623409 TAGAGGAAAGGAAATGGCGGCGG + Exonic
1002628739 5:180553166-180553188 TAGAGAAAATGAAATAATGGGGG - Intronic
1003250290 6:4422309-4422331 TAGAGAAAAGGAAAGTATATAGG + Intergenic
1003673460 6:8181322-8181344 GAGAGGAAAGTAAAGGAGGGAGG - Intergenic
1003850991 6:10222402-10222424 GAGAGTAAAGGGCAGGGTGGAGG - Intergenic
1004113728 6:12747343-12747365 TAAAGTAAAGGAAGAGAGGGAGG - Intronic
1005721578 6:28607559-28607581 TAGAGCAAAGAACAGCATGGAGG + Intronic
1005883114 6:30075082-30075104 GAGAGAAAAGCAAAGGATGAGGG - Intronic
1005923451 6:30419929-30419951 AACAGAAAAGGAAAGGTTGGGGG + Intergenic
1007059382 6:38923695-38923717 AAGAGCAAGGGACAGGATGGGGG + Intronic
1007239645 6:40415803-40415825 AAAGGTAAAGGCAAGGATGGAGG + Intronic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008922765 6:56860268-56860290 GAGAGTAAAGGAAAAGGTAGAGG + Intronic
1009267881 6:61579146-61579168 GACAGTAAAGCAAAGGAGGGAGG - Intergenic
1009428730 6:63542784-63542806 TAGAGCAATGGAAAGGATGTAGG - Intronic
1009863995 6:69373771-69373793 TAGTATAAAGGAAAGGAGGAAGG + Intronic
1009984012 6:70760619-70760641 TAGATGAAAGGAAAGACTGGAGG - Intronic
1010038337 6:71352412-71352434 TAAAGGAAAGTAAAGGAAGGAGG - Intergenic
1010307033 6:74336884-74336906 AAGAAAAAAGGAAAGGAGGGGGG - Intergenic
1010513998 6:76751577-76751599 TAGAGTAAAGGAGGGGAAGTGGG - Intergenic
1010666214 6:78632895-78632917 TAGAACAAAGGAAAGGCTGTAGG + Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1012518507 6:100092238-100092260 TAGAGTAAAGGAGGGGATGGGGG + Intergenic
1012621101 6:101344875-101344897 AAGATAAAAGGAAAGGGTGGAGG + Intergenic
1012672003 6:102064316-102064338 GAAAGGAAAGGAAAGGAAGGAGG - Intronic
1012676379 6:102118240-102118262 AAGAGAAAAAGAAAGGAGGGAGG + Intergenic
1012813706 6:103994564-103994586 TGGAGTAAAGGAAAGGAATTGGG + Intergenic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1013961560 6:115907228-115907250 GAGAGGCAAGGAAAGGATGCTGG - Intergenic
1014703835 6:124722455-124722477 TGGGGTAAGGGAAAGAATGGAGG + Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1016033460 6:139361566-139361588 TATAGTCAAAGAAAGCATGGAGG - Intergenic
1016318723 6:142818982-142819004 CAGAAGAAAGGAAAGGAGGGAGG + Intronic
1016755961 6:147687247-147687269 GAGAGGAAAGGAAGGGAAGGAGG - Intronic
1016792992 6:148086031-148086053 TTGGGTAAAGGAAAGTCTGGAGG + Intergenic
1017118515 6:151001923-151001945 TTAAGTAAAGGAAGGGAGGGTGG + Intronic
1017220798 6:151963095-151963117 AAGAGCAAAGGAAGGGAGGGAGG - Intronic
1017283931 6:152652737-152652759 TAGTGGAAAGGAAAAGAAGGTGG + Intergenic
1017484810 6:154892681-154892703 CAGGGGAAAAGAAAGGATGGGGG - Intronic
1018136965 6:160788408-160788430 TAGAGGAAAACAAAGGAAGGAGG - Intergenic
1018555344 6:165043820-165043842 GAGAGAGTAGGAAAGGATGGAGG + Intergenic
1018993953 6:168696421-168696443 TACAGGAAAGTAAAGTATGGGGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019937695 7:4267189-4267211 AGGGGTAAAGGAAAGGAAGGAGG - Exonic
1022307974 7:29167898-29167920 CAGAGGGAAGGAAAGCATGGGGG - Intronic
1023089056 7:36600867-36600889 AAGAGAGAAGGAAAAGATGGCGG - Intronic
1023203066 7:37719900-37719922 TAGAAATAAGGCAAGGATGGGGG + Intronic
1023705015 7:42932227-42932249 GAGAGTAAAGGAAAGGTGAGGGG - Exonic
1024678984 7:51663769-51663791 TAGAGTCAGGGAAAGGCAGGGGG - Intergenic
1025172070 7:56768127-56768149 TAGAGGACAGGAAAGGAAGTGGG + Intergenic
1025321638 7:58100489-58100511 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1025474786 7:60905749-60905771 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1025480927 7:60981798-60981820 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1025512217 7:61584125-61584147 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1025565844 7:62433127-62433149 TAGAGACAAGGAAAGGAGGAAGG + Intergenic
1025699797 7:63807428-63807450 TAGAGGACAGGAAAGGAAGTGGG - Intergenic
1026264777 7:68786658-68786680 TAGATTAAATTAAAAGATGGAGG + Intergenic
1027363709 7:77435009-77435031 TAGAGAACAGGAAGGGATTGGGG + Intergenic
1027478153 7:78659623-78659645 AAGGGTAAAGGAGAGGATGCAGG + Intronic
1028368156 7:90059225-90059247 TAGAGTAAGTGAAAGCAAGGTGG - Intergenic
1028547328 7:92017985-92018007 TTGAGTAATGGAAAGGGAGGAGG + Intronic
1029729641 7:102430820-102430842 AAGAGAAAAGGAAGGGAGGGAGG + Intergenic
1030068989 7:105682244-105682266 AAGAGTTCAGGAGAGGATGGTGG + Intronic
1031233562 7:119142395-119142417 TAAAATAAAGGTAAGGAAGGGGG + Intergenic
1031803887 7:126283676-126283698 TAGAAGAAAGGAAATGAAGGGGG - Intergenic
1031968921 7:128049478-128049500 GAGAGGAAAGGAAAGGAAGAGGG - Intronic
1032190632 7:129763623-129763645 GAGCATTAAGGAAAGGATGGAGG + Intergenic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1032919427 7:136528314-136528336 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1033003797 7:137537911-137537933 GAGAGGAAAGGAAAGGAAAGAGG + Intronic
1033195731 7:139325828-139325850 AAGATTGAAGGACAGGATGGAGG + Intergenic
1034423555 7:151001489-151001511 TAAAGAAAAGGAAAGGTTAGAGG - Intronic
1034464069 7:151215445-151215467 TAGAGTAAAGAAAAGGTAGTAGG + Intronic
1035306889 7:157939044-157939066 TAAAGTAAAGTAAAGCATGCAGG + Intronic
1035415773 7:158684340-158684362 TTAAGAAAAGGAAAGGAGGGAGG + Intronic
1036487236 8:9190241-9190263 TACACTTGAGGAAAGGATGGAGG - Intergenic
1036548256 8:9792666-9792688 GAAAGTAAAGGAAAGGAAAGGGG + Intergenic
1036548259 8:9792671-9792693 TAAAGGAAAGGAAAGGGGGGAGG + Intergenic
1037230003 8:16646682-16646704 TGGAGTAAATGATAGGAAGGAGG + Intergenic
1037652698 8:20853312-20853334 GAAAGGAAAGGAAAGGGTGGTGG - Intergenic
1038452465 8:27648841-27648863 GAGAGAGAAGGAAAGGAGGGAGG + Intronic
1038452485 8:27648930-27648952 AAGAGGTAAGGAAAGGAGGGAGG + Intronic
1038497323 8:28012952-28012974 GAGAGAAAGAGAAAGGATGGGGG + Intergenic
1038806206 8:30794493-30794515 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
1039005980 8:33037558-33037580 TTGGTTAAAGGAAAGGAGGGTGG - Intergenic
1040634787 8:49260288-49260310 TACAGTAAAGGAAAGCATATTGG - Intergenic
1041624353 8:60008351-60008373 TAGATAAAATGAATGGATGGAGG + Intergenic
1041745293 8:61202045-61202067 TAGAGGAAAACAAAGGAAGGAGG + Intronic
1042528483 8:69791013-69791035 TAGAAAGAAGGAAAGGAGGGAGG + Intronic
1042635099 8:70865939-70865961 TAGGGTGAAGGAAAGTATTGAGG + Intergenic
1042886866 8:73562184-73562206 CATAGTAAAAGAAAAGATGGAGG + Intronic
1043369123 8:79570869-79570891 TAGGGTAAAGAAATGTATGGAGG - Intergenic
1043508352 8:80924814-80924836 CAGAGAAATGGAAAGGTTGGTGG + Intergenic
1043745839 8:83872349-83872371 TTTAGTAACTGAAAGGATGGAGG - Intergenic
1043835118 8:85036793-85036815 GAGAGGAGAGGAAAGGAGGGAGG + Intergenic
1044998065 8:97856042-97856064 GAAAGGAAAGGAAAGGAGGGAGG + Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045278683 8:100729875-100729897 AAGAGGAAAGGAAAGGAAAGGGG - Intergenic
1045290164 8:100826138-100826160 AAGGGTAATGGCAAGGATGGTGG - Intergenic
1045480826 8:102590835-102590857 TAGACTAGAGGAAAGGATAAGGG + Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1046734039 8:117756949-117756971 TACAGGAAAGGAAAGGATGTAGG + Intergenic
1046786168 8:118268999-118269021 GAGAGTAAAAGAAAGGATGTGGG + Intronic
1047192140 8:122687742-122687764 GAGAGGGAAGGAAAGGAGGGTGG + Intergenic
1047474490 8:125213592-125213614 AAGAGGAAAGGAAAGGAAAGAGG - Intronic
1047713240 8:127572537-127572559 TAGAGTAGAGCATAGAATGGTGG + Intergenic
1048803432 8:138216486-138216508 TGGAGAAAGGGAAAGGATGCAGG + Intronic
1050242318 9:3649907-3649929 CAGAGTACAGGAAAGGAAGATGG + Intergenic
1050371179 9:4922889-4922911 TAGGGCAATGGAAAGTATGGAGG - Intergenic
1051384694 9:16495065-16495087 TGGAGTAAAGAACAGGTTGGCGG + Intronic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052744425 9:32426236-32426258 TAGAGGAAAGCAAAGGAAGCTGG + Intronic
1053627106 9:39885904-39885926 TGCAGTAGAGGAAAGGATGAAGG + Intergenic
1053698419 9:40661690-40661712 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1053778886 9:41580118-41580140 TGCAGTAGAGGAAAGGATGAAGG - Intergenic
1053944424 9:43291913-43291935 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1054166846 9:61790358-61790380 TGCAGTAGAGGAAAGGATGAAGG - Intergenic
1054216781 9:62364799-62364821 TGCAGTAGAGGAAAGGATGAAGG - Intergenic
1054254384 9:62799630-62799652 TAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1054309710 9:63461097-63461119 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1054408499 9:64785239-64785261 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1054441652 9:65269050-65269072 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1054488628 9:65752439-65752461 AAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1054670701 9:67790541-67790563 TGCAGTAGAGGAAAGGATGAAGG + Intergenic
1055087723 9:72331339-72331361 TAGGGTAAGGGAAAGAATGAAGG - Intergenic
1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1055289889 9:74771272-74771294 GAGAGAACAGGAAATGATGGTGG - Intronic
1055572901 9:77634449-77634471 GAAAGGAAAGGAAAGGAAGGAGG + Intronic
1055610141 9:78014156-78014178 AAGAGAAAAGGAAATAATGGAGG + Intronic
1055920103 9:81451348-81451370 TAAGGTAAAGGCAAGGGTGGTGG + Intergenic
1055965235 9:81859503-81859525 TAGAGAAAAGGAAGGAAGGGGGG - Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056206060 9:84320527-84320549 TACAGCACAGGAAAGGAAGGAGG - Intronic
1056801204 9:89693256-89693278 TAGAGGAATGAAATGGATGGTGG + Intergenic
1057010948 9:91600837-91600859 TAGAGCAAAGGAAAGGCATGTGG - Intronic
1057409490 9:94805004-94805026 TAGAATGAAGGCCAGGATGGTGG + Intronic
1058165553 9:101614954-101614976 TAAAATAAATGAAAGGGTGGTGG + Intronic
1059035341 9:110748213-110748235 TAAAGAAAAGGAAAAGAGGGAGG - Intronic
1059354231 9:113687085-113687107 CAGAGAAGAGGAAAGGAGGGAGG + Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1062175087 9:135157238-135157260 AAAAGAAAAGGAAAGAATGGAGG - Intergenic
1203376847 Un_KI270442v1:383398-383420 TAGAGAAAGGGAAAGGGTGAGGG - Intergenic
1203587560 Un_KI270747v1:20491-20513 AAGAGGAAAGGAAGGGAGGGAGG - Intergenic
1185504923 X:625025-625047 GGGAGGAAAGGAAAGGAGGGAGG - Intronic
1185999178 X:4989169-4989191 TAGAGGATAGGAAGGGAAGGAGG - Intergenic
1186202004 X:7164429-7164451 AAGAGTACAGAAAAGGAAGGAGG - Intergenic
1186885305 X:13907228-13907250 AAGAGTAAATGAAAAGATGTAGG - Intronic
1186950016 X:14614198-14614220 GAGAGTAATGGGAAAGATGGAGG + Intronic
1188218936 X:27515814-27515836 TACATCAAAGGAATGGATGGTGG - Intergenic
1188632438 X:32382063-32382085 GAGAATAAAGGAAGGGATTGAGG - Intronic
1189358773 X:40332218-40332240 TTGGGTAAAGTAAAGGATGCTGG + Intergenic
1189580747 X:42403828-42403850 TATAATAAAGGAAAGAATGAAGG + Intergenic
1190524626 X:51316315-51316337 TAGAATTAAGGAAAGTTTGGAGG + Intergenic
1190545646 X:51523698-51523720 TAGAATTAAGGAAAGTTTGGAGG - Intergenic
1191939395 X:66462057-66462079 CAGAGTAAATGAAATGGTGGGGG + Intergenic
1192044436 X:67657279-67657301 CTGAGTAAAGGTAAGGATAGGGG - Intronic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1192433104 X:71125859-71125881 GAGGGTCAAGGAAGGGATGGGGG - Intronic
1192631375 X:72780405-72780427 TGGCGTCAAGGAAAGGCTGGAGG + Intronic
1192650334 X:72940396-72940418 TGGCGTCAAGGAAAGGCTGGAGG - Intronic
1193393464 X:80956718-80956740 TAGGGAAAAGGAAAGGATTAGGG + Intergenic
1193732496 X:85117587-85117609 GAGAGAAAAGGAAAGGTTAGGGG + Intergenic
1195702002 X:107712600-107712622 AAGAGCAAAGGAAAGGGGGGTGG + Intergenic
1195702141 X:107713666-107713688 GAGAGTAAAGGCAAGGAGGGGGG - Exonic
1195925379 X:110019459-110019481 TAGAGTAGTGTAAAGGATAGAGG - Intronic
1196011684 X:110895015-110895037 TAGCATAAAGGCAAGGAAGGGGG + Intergenic
1196208134 X:112964373-112964395 TAAAGTACAGGAAAAGAAGGTGG - Intergenic
1196972760 X:121127235-121127257 TACAGTAAAGAAAAAAATGGTGG - Intergenic
1198535154 X:137577956-137577978 TAGAAGAAATGAAAGGATGCAGG + Intergenic
1199903478 X:152200865-152200887 TATAGAAAAGGAGAGGATTGAGG - Intronic
1200445117 Y:3252459-3252481 TGTAGTAAAGAAAAGCATGGTGG - Intergenic
1201096707 Y:10627143-10627165 TAGTGTAATGGAAGGGATTGGGG - Intergenic
1201549922 Y:15209199-15209221 GAAAGGAAAGGAAAGGAAGGGGG + Intergenic