ID: 1056110676

View in Genome Browser
Species Human (GRCh38)
Location 9:83391718-83391740
Sequence GACAACGCAGTGATTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056110674_1056110676 4 Left 1056110674 9:83391691-83391713 CCCTTGAGAGAAGAAAATGCTGC 0: 1
1: 0
2: 2
3: 36
4: 358
Right 1056110676 9:83391718-83391740 GACAACGCAGTGATTAGAGCAGG No data
1056110675_1056110676 3 Left 1056110675 9:83391692-83391714 CCTTGAGAGAAGAAAATGCTGCT 0: 1
1: 1
2: 2
3: 60
4: 378
Right 1056110676 9:83391718-83391740 GACAACGCAGTGATTAGAGCAGG No data
1056110673_1056110676 21 Left 1056110673 9:83391674-83391696 CCATTGACTACTGAAGACCCTTG 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1056110676 9:83391718-83391740 GACAACGCAGTGATTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056110676 Original CRISPR GACAACGCAGTGATTAGAGC AGG Intronic
No off target data available for this crispr