ID: 1056110771

View in Genome Browser
Species Human (GRCh38)
Location 9:83392398-83392420
Sequence CTTTGGTACTGGGCGTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056110771_1056110782 15 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110782 9:83392436-83392458 TCAGGAGTCAGGTGCATGAGGGG No data
1056110771_1056110778 -3 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110778 9:83392418-83392440 AAGGTTGGAAGAGCTGGTTCAGG No data
1056110771_1056110780 13 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110780 9:83392434-83392456 GTTCAGGAGTCAGGTGCATGAGG No data
1056110771_1056110781 14 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110781 9:83392435-83392457 TTCAGGAGTCAGGTGCATGAGGG No data
1056110771_1056110776 -9 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110776 9:83392412-83392434 GTACCAAAGGTTGGAAGAGCTGG No data
1056110771_1056110779 4 Left 1056110771 9:83392398-83392420 CCTGCATACGCCCAGTACCAAAG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1056110779 9:83392425-83392447 GAAGAGCTGGTTCAGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056110771 Original CRISPR CTTTGGTACTGGGCGTATGC AGG (reversed) Intronic
903140704 1:21337457-21337479 CTTTGGTCCAGGTAGTATGCAGG + Intronic
908002901 1:59698443-59698465 CTTTGGTAATGGGGGTGTGGGGG - Intronic
909847031 1:80407956-80407978 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
911932714 1:103925211-103925233 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
914391784 1:147230280-147230302 CTTTGGTTCTGTTTGTATGCTGG + Intronic
914403546 1:147346819-147346841 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
917842185 1:178989871-178989893 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
918189503 1:182159813-182159835 CTTTGGTATTGGGGTAATGCTGG + Intergenic
918418711 1:184339620-184339642 CTTTGGTTCTGTGTATATGCTGG + Intergenic
922113334 1:222584410-222584432 CTTTGGTACTGGGAATGGGCTGG - Intronic
922696300 1:227732738-227732760 CTTGGGGACTGGGCGCATGTCGG - Intronic
923875163 1:238039385-238039407 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1063326810 10:5111804-5111826 CTTTGGTTCTGTGTATATGCTGG - Intronic
1066812378 10:39356730-39356752 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1067314832 10:45151514-45151536 CTTTGGTACTGGTCATCTGGAGG + Intergenic
1069353992 10:67562358-67562380 CTTTGGTTCTGTTTGTATGCTGG - Intronic
1074241195 10:111640967-111640989 CTTTGGTTCTGGTTATATGCTGG - Intergenic
1074693900 10:116030495-116030517 GTTTGGAAGTGGGCATATGCAGG - Intergenic
1077952456 11:6975166-6975188 CTTTGGTTCTGTTCATATGCTGG + Intronic
1079462168 11:20691556-20691578 CTTTGGTTCTGTTTGTATGCTGG + Intronic
1079848345 11:25498388-25498410 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1080067017 11:28029398-28029420 CTTTGGTTCTGTGTATATGCTGG - Intronic
1080082311 11:28236079-28236101 CTTTGGTTCTGTGTATATGCTGG + Intronic
1080696790 11:34609696-34609718 ACTTGGGCCTGGGCGTATGCTGG + Intergenic
1080914528 11:36642726-36642748 CTTTGGTTCTGTTCATATGCTGG - Intronic
1082298337 11:50472676-50472698 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1083497955 11:63075228-63075250 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1085509301 11:77079344-77079366 CTTTGGTAATGGGGTAATGCTGG + Intronic
1090339329 11:126002667-126002689 CTGTGGTACTTGGCATATTCTGG + Intronic
1092706830 12:11294087-11294109 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1093085607 12:14863835-14863857 CTTTGGTATTGGGATGATGCTGG + Intronic
1093282485 12:17211423-17211445 CTTTGCTGCTGTGTGTATGCTGG + Intergenic
1094282782 12:28758447-28758469 CTTTGGTACTAGGGTAATGCTGG + Intergenic
1097561001 12:61206153-61206175 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1099086620 12:78254294-78254316 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1103153230 12:118660158-118660180 CTTTGGTTCTGTTAGTATGCTGG + Intergenic
1106063374 13:26318443-26318465 CTTTGGTACCGGGGTAATGCTGG - Intronic
1107743592 13:43481001-43481023 CTTTGGTATCAGGCTTATGCTGG - Intronic
1110460604 13:75740727-75740749 CATTGGTACTGGGCTGATTCTGG + Intronic
1111694502 13:91606227-91606249 CTTTGGTTCTGTTCATATGCTGG + Intronic
1114081062 14:19201597-19201619 CTTTGCTACTGGGCTCCTGCGGG + Intergenic
1114932750 14:27494158-27494180 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1116197987 14:41754036-41754058 CTTTGGTTCTGTTTGTATGCTGG + Intronic
1116398262 14:44473447-44473469 CTTTGGTTCTGTGCATATGCTGG + Intergenic
1117280678 14:54237733-54237755 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1117808233 14:59517038-59517060 CTTTGGTTCTGTTTGTATGCTGG - Intronic
1120784770 14:88523103-88523125 CTTTGGTATTGGGGTAATGCTGG - Intronic
1126234248 15:46364000-46364022 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1129096597 15:73215768-73215790 CTTTGGTATTAGGCTGATGCTGG + Intronic
1131435816 15:92420744-92420766 CTCTGGTATTGGGCGTCTGAGGG - Intronic
1134823360 16:17264656-17264678 CTTGGGTGCTGGGCATATGATGG - Intronic
1136914921 16:34178857-34178879 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1141210037 16:81970199-81970221 CTTTGGCACTGGGGTAATGCTGG + Intergenic
1145715107 17:27012012-27012034 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1147698905 17:42379246-42379268 CTTTTTTCCTGGCCGTATGCGGG - Intronic
1150091039 17:62325077-62325099 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1156087008 18:33417863-33417885 CTCTGGTACTGGGCTTTTTCTGG - Intronic
1160285043 18:77534418-77534440 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1162707225 19:12564182-12564204 TTTTGGTACCAGGCATATGCAGG - Intronic
1167595161 19:50423617-50423639 CTGGGGTACGGGGCATATGCCGG - Exonic
1168267201 19:55229503-55229525 CTTGGTTACTGGGGGTAAGCAGG + Intergenic
928067164 2:28176005-28176027 CTTTGATTCTGGGTGCATGCAGG - Intronic
929812445 2:45201639-45201661 CTTTGGTTCTGGGTGCATGCAGG - Intergenic
932642601 2:73464314-73464336 CTTTGGTTCTGTGTATATGCTGG - Intronic
932829223 2:74972371-74972393 CTTTGGTTCTGGTTATATGCTGG + Intergenic
932985831 2:76725110-76725132 CTTTGGTTCTGGTTATATGCTGG + Intergenic
932992014 2:76799320-76799342 CTTTGGTTCTGGTTATATGCTGG - Intronic
933579412 2:84107898-84107920 CTTTGGTACTGTTTATATGCTGG - Intergenic
933600716 2:84327030-84327052 CATTGGTCCTGAGCCTATGCAGG + Intergenic
934511902 2:94951687-94951709 CTTTGGTACTGTTTATATGCTGG + Intergenic
936159436 2:110072513-110072535 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
936185225 2:110298819-110298841 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
938498568 2:131817892-131817914 CTTTGCTACTGGGCTCCTGCAGG - Intergenic
940433939 2:153628618-153628640 CTTTGGTTCTGTTCATATGCTGG + Intergenic
940532839 2:154902322-154902344 TTTTGGTATTAGGCTTATGCTGG + Intergenic
1175219265 20:57407655-57407677 GGTGGGTACTGGGCGTAGGCCGG - Exonic
1180499711 22:15921088-15921110 CTTTGCTACTGGGCTCCTGCGGG - Intergenic
1183442776 22:37832642-37832664 CTTTGGTACTGGTCATCTGCAGG + Exonic
951068481 3:18296048-18296070 CTTTGATTCTTGGTGTATGCAGG - Intronic
953114082 3:39974556-39974578 CTTTGGTACCGGGATGATGCTGG - Intronic
955498645 3:59562609-59562631 GTTTGTTACTGGGCTTATTCTGG + Intergenic
955865631 3:63380771-63380793 CTTTGGTTCTGTGTATATGCTGG - Intronic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
957207105 3:77212847-77212869 CTTTGGTTCTGTTTGTATGCTGG + Intronic
958171100 3:89941360-89941382 CTTTGGTACTGTTTATATGCTGG + Intergenic
958749472 3:98177952-98177974 CTTTGGTTCTGTTTGTATGCTGG - Intronic
959724175 3:109525206-109525228 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
962524814 3:136228148-136228170 CTTTGGTTCTGTTCATATGCTGG - Intergenic
962548939 3:136468855-136468877 CTTTGGTTCTGTTCATATGCTGG - Intronic
964587775 3:158326502-158326524 CTTTGGTTCTGTGTATATGCTGG + Intronic
965909176 3:173750128-173750150 CTTTGGTACAGGGCGAATCAGGG - Intronic
970900873 4:21158307-21158329 CTTTGATACTGGGGTAATGCTGG - Intronic
971557065 4:28026088-28026110 ATCTGGTACTGTGCCTATGCTGG - Intergenic
973347408 4:49071703-49071725 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
973722410 4:53738505-53738527 CTTTGGTTCTGTTTGTATGCTGG - Intronic
975036982 4:69696371-69696393 CTTTGGTTCTGTTCATATGCTGG + Intergenic
976771183 4:88654156-88654178 CTTTGGTGCTGGGGATATGATGG + Intronic
977515866 4:98020290-98020312 CTTTGGTTCTGTTCATATGCTGG + Intronic
979800011 4:124896746-124896768 CTTTGGTTCTGTTCATATGCTGG - Intergenic
979827550 4:125257932-125257954 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
981634782 4:146864237-146864259 CTGTGGAACTGGGTGGATGCTGG - Intronic
983799306 4:171906649-171906671 CTTTGGTATTGGGATGATGCTGG - Intronic
985224198 4:187742258-187742280 CTTTGGTATTGGGGTGATGCTGG - Intergenic
987866426 5:23545678-23545700 CTTTGCTACTGGGGTGATGCTGG + Intergenic
987913883 5:24186559-24186581 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
989244999 5:39244412-39244434 CTTTGGTTCTGTTTGTATGCTGG + Intronic
989593502 5:43134035-43134057 CTTTGGTACTGGGGTAATGCTGG - Intronic
990072741 5:51805376-51805398 CTTTAGTACTGGGCATGTCCAGG + Intergenic
990233636 5:53742515-53742537 TTTTGGTACTGGGGTGATGCTGG - Intergenic
992336134 5:75771820-75771842 CTTTGGTTCTGTTCATATGCTGG + Intergenic
992650030 5:78850331-78850353 CTTTGGTTCTGGTTATATGCTGG + Intronic
993406410 5:87516784-87516806 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
998572012 5:143269410-143269432 TTTTGGTACTGGGGTTATGCTGG + Intergenic
998931324 5:147184623-147184645 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1001854406 5:174998601-174998623 CTTTGCTTCTGGGAGTTTGCTGG + Intergenic
1002162444 5:177323512-177323534 CTTTGGTACTGGGGTAATGCTGG - Intergenic
1003151551 6:3555926-3555948 CTTTGATACTGGGGTAATGCTGG - Intergenic
1003818025 6:9863500-9863522 CTTTGGAACTGGGCAGAAGCTGG - Intronic
1004303999 6:14483841-14483863 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1009374456 6:62950270-62950292 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1009579500 6:65513659-65513681 CTTTGGTTCTGTTCATATGCTGG - Intronic
1011081972 6:83499504-83499526 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1012285085 6:97378803-97378825 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1012325051 6:97906379-97906401 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1014219373 6:118784998-118785020 CCTTGGCACTGGGCGGAGGCAGG + Intergenic
1014660748 6:124167791-124167813 CTTTGGTTCTGTTTGTATGCTGG + Intronic
1016018830 6:139214347-139214369 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1020600981 7:10274068-10274090 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1020640750 7:10750938-10750960 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1020645321 7:10808173-10808195 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1022765305 7:33405117-33405139 CTTTGGTTCTGTTTGTATGCTGG + Intronic
1031314265 7:120237100-120237122 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1034496541 7:151426760-151426782 CTTTGGGACTGAGCGAATGATGG + Intergenic
1036050469 8:5190656-5190678 CTTTGGTATTGGGATGATGCTGG - Intergenic
1038870281 8:31486371-31486393 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1038877647 8:31569215-31569237 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1039863586 8:41480926-41480948 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1040357161 8:46629978-46630000 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1040398469 8:47022461-47022483 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1040993055 8:53372855-53372877 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1042410007 8:68454248-68454270 CTGTGGTACTGGGCCAATGCTGG + Intronic
1043336394 8:79181594-79181616 CTTTGGTACTGGGAGAGTGGGGG - Intergenic
1046187353 8:110739348-110739370 CTTTGGTTCTGGGTGGATGCTGG + Intergenic
1046208340 8:111034013-111034035 TTTTGGTATTGGGATTATGCTGG - Intergenic
1050387329 9:5104565-5104587 CTTTGGTATCGGGCTGATGCTGG - Intronic
1052725849 9:32227317-32227339 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1053181670 9:35976680-35976702 CTTTGGTCCTGGGAGTAAGGGGG + Intergenic
1053409565 9:37906817-37906839 ATTTGGTACTGGGGGTGTGAAGG - Intronic
1053568382 9:39277644-39277666 CTTTGGTTCTGTGTATATGCTGG - Intronic
1054128761 9:61341366-61341388 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1056110771 9:83392398-83392420 CTTTGGTACTGGGCGTATGCAGG - Intronic
1058490282 9:105491771-105491793 CTTTGGTTCTGTTTGTATGCTGG + Intronic
1203440730 Un_GL000219v1:5652-5674 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1203511608 Un_KI270741v1:124035-124057 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1186761398 X:12726606-12726628 CTTTGGTAGTGGATGTATGTGGG + Intergenic
1192827721 X:74715815-74715837 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1193002320 X:76576723-76576745 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1193727615 X:85061153-85061175 CTTTGGTTCTGTTTGTATGCCGG + Intronic
1193816898 X:86115593-86115615 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1196897123 X:120348113-120348135 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1197433596 X:126397547-126397569 CTTTGGTAATGGGGTTATACTGG + Intergenic
1197478327 X:126950593-126950615 CTTTGGTTCTGTTTGTATGCTGG - Intergenic
1198088968 X:133308754-133308776 CTTTGTTGCTGGGGGTATGGGGG - Intronic
1201080543 Y:10240443-10240465 CTTTGGTTCTGTTTGTATGCTGG + Intergenic
1201350599 Y:13036704-13036726 CTTTGGTACCGGGAAGATGCTGG - Intergenic