ID: 1056120071

View in Genome Browser
Species Human (GRCh38)
Location 9:83478951-83478973
Sequence TCTAGGGACCCGTAGTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056120071_1056120075 -5 Left 1056120071 9:83478951-83478973 CCTATGCACTACGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1056120075 9:83478969-83478991 CTAGAACATGGCTTAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056120071 Original CRISPR TCTAGGGACCCGTAGTGCAT AGG (reversed) Intronic
907816034 1:57919097-57919119 TCCAGGGACACATAGTGAATGGG - Intronic
1078718385 11:13860932-13860954 TCTGGGGATGCCTAGTGCATGGG - Intergenic
1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG + Intergenic
1082979908 11:59110457-59110479 TCTAGGGATCTGTACAGCATGGG + Intronic
1091806445 12:3360005-3360027 TCCAGGGATCCACAGTGCATGGG + Intergenic
1093667758 12:21834580-21834602 TCTAGGGAGGCGAAGTGCTTGGG + Intronic
1099711741 12:86235152-86235174 TCTATAGACCCGGAGTTCATGGG - Intronic
1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG + Intronic
1126997449 15:54461367-54461389 GCTAGGGACCAGTAGTGTTTTGG - Intronic
1135188037 16:20331926-20331948 TCCAGAGACCCGTGGGGCATCGG + Intergenic
1155460581 18:26077515-26077537 ACAAGGTACACGTAGTGCATTGG - Intronic
1161163335 19:2772657-2772679 TCTAGGGACCCGCCGTACACTGG - Intronic
1163860918 19:19742490-19742512 ACTAGGGCCCTGTAGAGCATGGG - Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
926731219 2:16037200-16037222 TCTAGGGAACCATCTTGCATGGG + Intergenic
930090156 2:47525949-47525971 TCAGGGGACCCGCAGTGGATGGG - Intronic
934685899 2:96321521-96321543 TCTAGGGACCGGTAGCTCAGAGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG + Intergenic
978523115 4:109636927-109636949 TCTAGAGACCAGTAGTCCAGTGG + Intronic
988793124 5:34627317-34627339 TCTAGGGACTCTAAGTGCCTTGG - Intergenic
1000305001 5:159986982-159987004 TCTAGGGACCCTTAAGGCAGAGG - Intergenic
1008398749 6:51039298-51039320 TCTAGGGATCAGTAGGGGATTGG - Intergenic
1019488662 7:1301004-1301026 TCTAGGGAGCCGCAGGGCAGAGG - Intergenic
1019609216 7:1928495-1928517 TCTAGGGACCTGCAGGTCATGGG - Intronic
1023623681 7:42096278-42096300 TCTAGGGACCCTGACTCCATCGG - Intronic
1027867132 7:83662490-83662512 TCTAGAAAACCGTAGTTCATAGG - Intergenic
1036960196 8:13237123-13237145 TCTAAGGACCAGTAATGCAGTGG + Intronic
1038307490 8:26417775-26417797 CCTTGGGACCCGAAGTGCTTTGG - Intronic
1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG + Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1193808371 X:86021197-86021219 GCTTGGGACCCGAAGTGCTTCGG - Intronic
1196865100 X:120064106-120064128 TCTAGGGAACCCTAATGCACTGG + Intergenic
1196877993 X:120172174-120172196 TCTAGGGAACCCTAATGCACTGG - Intergenic