ID: 1056120071

View in Genome Browser
Species Human (GRCh38)
Location 9:83478951-83478973
Sequence TCTAGGGACCCGTAGTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056120071_1056120075 -5 Left 1056120071 9:83478951-83478973 CCTATGCACTACGGGTCCCTAGA No data
Right 1056120075 9:83478969-83478991 CTAGAACATGGCTTAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056120071 Original CRISPR TCTAGGGACCCGTAGTGCAT AGG (reversed) Intronic