ID: 1056120075

View in Genome Browser
Species Human (GRCh38)
Location 9:83478969-83478991
Sequence CTAGAACATGGCTTAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056120067_1056120075 16 Left 1056120067 9:83478930-83478952 CCCTGGAATACAGAGACTGTACC 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1056120075 9:83478969-83478991 CTAGAACATGGCTTAATCAATGG No data
1056120068_1056120075 15 Left 1056120068 9:83478931-83478953 CCTGGAATACAGAGACTGTACCT 0: 1
1: 0
2: 1
3: 19
4: 215
Right 1056120075 9:83478969-83478991 CTAGAACATGGCTTAATCAATGG No data
1056120071_1056120075 -5 Left 1056120071 9:83478951-83478973 CCTATGCACTACGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1056120075 9:83478969-83478991 CTAGAACATGGCTTAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056120075 Original CRISPR CTAGAACATGGCTTAATCAA TGG Intronic
No off target data available for this crispr