ID: 1056121988

View in Genome Browser
Species Human (GRCh38)
Location 9:83497688-83497710
Sequence AAAGAGAAGCAGAGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1889
Summary {0: 1, 1: 0, 2: 20, 3: 181, 4: 1687}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056121988_1056121994 16 Left 1056121988 9:83497688-83497710 CCTTCCACTCTCTGCTTCTCTTT 0: 1
1: 0
2: 20
3: 181
4: 1687
Right 1056121994 9:83497727-83497749 GCTTCCATGAAGACACAAGATGG No data
1056121988_1056121992 -9 Left 1056121988 9:83497688-83497710 CCTTCCACTCTCTGCTTCTCTTT 0: 1
1: 0
2: 20
3: 181
4: 1687
Right 1056121992 9:83497702-83497724 CTTCTCTTTTGTAGGGACTTTGG No data
1056121988_1056121996 27 Left 1056121988 9:83497688-83497710 CCTTCCACTCTCTGCTTCTCTTT 0: 1
1: 0
2: 20
3: 181
4: 1687
Right 1056121996 9:83497738-83497760 GACACAAGATGGAAACAGCCAGG No data
1056121988_1056121993 -6 Left 1056121988 9:83497688-83497710 CCTTCCACTCTCTGCTTCTCTTT 0: 1
1: 0
2: 20
3: 181
4: 1687
Right 1056121993 9:83497705-83497727 CTCTTTTGTAGGGACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056121988 Original CRISPR AAAGAGAAGCAGAGAGTGGA AGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900323389 1:2095823-2095845 AAAGAGGAGAAGGGAGGGGAAGG - Intronic
900369546 1:2325254-2325276 AAAGAGAGGCAGAGAGAGAGAGG - Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900935307 1:5762221-5762243 AAAAAGAAGAATAAAGTGGAAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901243391 1:7708499-7708521 AAAAAGAAAAAGACAGTGGAGGG + Intronic
901310768 1:8267883-8267905 AAAGAGAAGTGCAGAGTGAAGGG + Intergenic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901470470 1:9452508-9452530 AAAGAGAAGCAGAAAATAAATGG + Intergenic
901479646 1:9516128-9516150 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
901710860 1:11113965-11113987 AGAGAGAAGTACAGAGTGAAGGG - Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902051606 1:13567769-13567791 AAAGAGAGGCAGAGAGAGACAGG + Intergenic
902051623 1:13567862-13567884 AAAGAGAGGCAGAGAGAGAGAGG + Intergenic
902051631 1:13567889-13567911 AAAGAGAGGCAGAGAGAGAGGGG + Intergenic
902051695 1:13568187-13568209 AAAGAGAGGCAGAGAGAGAGGGG + Intergenic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902288969 1:15424490-15424512 AAAGAGAACCTGAGAGTGCAGGG + Intronic
902625365 1:17673287-17673309 GAAGAGACACACAGAGTGGAGGG - Intronic
902664177 1:17926006-17926028 ACAGAGACTCAGAGAGGGGAAGG + Intergenic
902732287 1:18377353-18377375 AAAGAGAACCAAAGGGTGGATGG - Intronic
903158801 1:21469723-21469745 AAAGAAAAGCAGAGAGTACCCGG + Intronic
903237946 1:21962479-21962501 AAAGATAATCAGAGATTAGATGG - Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
903639624 1:24849342-24849364 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
904052934 1:27651136-27651158 GAAGAGAAGCAAAGAAAGGAAGG + Intergenic
904078830 1:27859154-27859176 AAGGGGAAGCAGAGAGGTGACGG - Intergenic
904104764 1:28069915-28069937 AAATGGAAGAAGAGACTGGAGGG + Intronic
904201903 1:28825338-28825360 AGAGAGAGGCAGGGAGTGGCTGG + Intronic
904688010 1:32274562-32274584 AAAGAGGCCCAGAGAGGGGAAGG + Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905166382 1:36085465-36085487 AAAGAAAAGAAAAGAGTGGGCGG - Intronic
905190184 1:36227735-36227757 AGCAAGAAGCAGAGATTGGAGGG + Intronic
905364530 1:37442415-37442437 ACAGAGAGAGAGAGAGTGGAGGG - Intergenic
905364533 1:37442448-37442470 AGAGAGAGACGGAGAGTGGAGGG - Intergenic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
905601512 1:39256191-39256213 AAAGGTTAGCAGAGATTGGAAGG + Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
906275215 1:44510249-44510271 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
906435482 1:45792683-45792705 GAAGAGAAGAGGAGAGGGGAGGG - Intronic
906572560 1:46856558-46856580 AAAGACTTGCAGAGAGTAGAGGG - Intergenic
906599213 1:47109333-47109355 AAAGACTTGCAGAGAGTAGAGGG + Intronic
906936878 1:50222057-50222079 AAAGGGTTGCAGAGATTGGAGGG - Intergenic
907401421 1:54227166-54227188 AAGGAGAAGCAGAGAAGGGGGGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907855808 1:58302386-58302408 AGAGAGGAGTAGAGGGTGGAGGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907933308 1:59019777-59019799 CAAGAGATGCAGGGAGTGGCAGG + Intergenic
908117515 1:60954374-60954396 AAAAAGAAGGAGAGAGAGAAAGG + Intronic
908354661 1:63318235-63318257 AAAGAGGAAGAGAGAGAGGATGG - Intergenic
908397532 1:63740157-63740179 AAAGGGAAGGGAAGAGTGGAAGG - Intergenic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
908572967 1:65428381-65428403 AAGGAGACACAGAGAGGGGAAGG - Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908701515 1:66907404-66907426 GAAGAGAATGAGAGAGTTGAAGG - Intronic
908877803 1:68697750-68697772 AAAGAGCAGGAGATAGTTGAGGG + Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909128395 1:71705792-71705814 AAAGAAAAGAAAAGAGAGGAAGG + Intronic
909312687 1:74173314-74173336 AAAGATAAGGAGGGAGTGAATGG - Intronic
909805772 1:79872781-79872803 AAGGAGAATGAGAGAGTGAAGGG - Intergenic
909852306 1:80483632-80483654 AGAGAGAGAAAGAGAGTGGAAGG + Intergenic
910072967 1:83242149-83242171 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
910094082 1:83499962-83499984 AAAGAGATACAGAGAGTTGGAGG + Intergenic
910252075 1:85208382-85208404 AAAGTGGAGAAGAGAGTGAATGG - Intergenic
910378454 1:86598804-86598826 AAAAAGAAGAACAGAGTTGAAGG + Intergenic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
910982531 1:92973253-92973275 AGAGAGCAGCAGAGAGTGTCAGG - Intergenic
911054887 1:93701070-93701092 AAACAGGAGCAGAGAGGTGAAGG - Intronic
911099238 1:94080926-94080948 AAAGAAAATCACAGAGTGGCCGG + Intronic
911372499 1:97010884-97010906 AAAGAGAGGAAGAGAGTGAAAGG - Intergenic
911382161 1:97128891-97128913 AGAGAAAAGTAGAGTGTGGATGG + Intronic
911469314 1:98297290-98297312 AAATAGTAGTAGAGAATGGATGG + Intergenic
911490517 1:98559815-98559837 AAAGAGCAGCAGTGAATGGAAGG + Intergenic
911597145 1:99810598-99810620 AAAGAAAAGGAAAGAGTGGTGGG + Intergenic
911703815 1:100987413-100987435 AAAGAGAAGAAAAGATTAGAAGG - Intergenic
911736617 1:101343428-101343450 AGAGAGTACCAGAGAGGGGATGG - Intergenic
911935507 1:103965216-103965238 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
912392339 1:109312406-109312428 AAAGTGGGGGAGAGAGTGGATGG - Exonic
912406325 1:109441247-109441269 AAAAGGAAGGGGAGAGTGGAAGG - Intergenic
912717546 1:111992400-111992422 AAATAGAAGCTGAGAGTTAAAGG - Intergenic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
912913154 1:113783697-113783719 AAAGAGAAAAAGGAAGTGGAGGG - Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913288090 1:117245901-117245923 AAAAAAAAGCAGAGATGGGAGGG - Intergenic
913291775 1:117280128-117280150 AAAAATAAGCAGAGAGTGACCGG + Intergenic
913303133 1:117394567-117394589 AAACAGAAGAAGAAAGTGAATGG - Intronic
913324492 1:117614846-117614868 AGAGAGAACCCAAGAGTGGAAGG - Intronic
913509312 1:119547805-119547827 AAAGAGAGGAAGAAATTGGATGG + Intergenic
913685074 1:121223851-121223873 AAAGAAAAGCAGACAGGGGGTGG - Intronic
914036919 1:144011455-144011477 AAAGAAAAGCAGACAGGGGGTGG - Intergenic
914152535 1:145056476-145056498 AAAGAAAAGCAGACAGGGGGTGG + Intronic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914476645 1:148029099-148029121 AAAGAGAAAGAAAGAGAGGAAGG - Intergenic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915027084 1:152841264-152841286 AAAGAGAAGGAGAGAGAAAAGGG + Intergenic
915282426 1:154831669-154831691 AAAATCAAGCAGAGACTGGATGG - Intronic
915340110 1:155172837-155172859 AAAGAGCAGCAGGGACAGGAGGG + Exonic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916017996 1:160767265-160767287 GAAGAGATACAGAGAGGGGAGGG + Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916592176 1:166203016-166203038 AAATAAAAGCAGAGATGGGAAGG - Intergenic
916873523 1:168942917-168942939 AAAGAGAGAAAGAGATTGGAGGG - Intergenic
917000416 1:170351688-170351710 TGAGAGAAGCAGAGAGTGGTTGG + Intergenic
917028093 1:170663754-170663776 AAACAGAAGAAGAGAGAAGAAGG - Intronic
917149921 1:171932115-171932137 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
917881589 1:179342296-179342318 AAAGAGAAAAAGAGAGAGGGAGG - Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918400757 1:184160640-184160662 AAAGAGAGTCAGAGAGAGAAAGG + Intergenic
918437866 1:184534954-184534976 AAAGAGGAGCAGTGAGGGGCTGG + Intronic
918617098 1:186557494-186557516 AAGAAGAGACAGAGAGTGGAGGG - Intergenic
918646153 1:186907602-186907624 AAAGAGATGCAGAGAGGTTAAGG - Intronic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919174901 1:194007819-194007841 AAAGAGATTCAGAGAGGGGAAGG + Intergenic
919528883 1:198690745-198690767 AAAGAGAATCAGAGATCAGATGG - Intronic
919679006 1:200415446-200415468 AAAGAGAAGCAGAGAGTCCTTGG - Intergenic
919753885 1:201054571-201054593 AAAGAGACGAAGGGAGGGGAAGG + Intronic
919815513 1:201435959-201435981 AGAGAGAAACAGAGAGAGAAAGG + Intergenic
920098731 1:203503322-203503344 GAAGAGAAGGGGAGAGAGGAAGG - Intronic
920112333 1:203595933-203595955 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
920169756 1:204064566-204064588 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920169760 1:204064617-204064639 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920305502 1:205015767-205015789 ACAGACAAGCAGAGAGGTGAGGG + Intronic
920472391 1:206242408-206242430 AAAGAAAAGCAGACAGGGGGTGG - Intronic
920690307 1:208141659-208141681 AAAGAGAAGCAGGGAAGGCAGGG - Intronic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
920940836 1:210480728-210480750 AAAGGGAAGCAGAGGCTGGATGG - Intronic
920966124 1:210702317-210702339 AAAGAAAAACAGAAAATGGAGGG - Intronic
921177294 1:212606684-212606706 AAAGTGAAGCAAGGAGAGGAGGG - Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921399120 1:214700941-214700963 ATAGACAAGCAGAGAGGGAATGG + Intergenic
921495490 1:215835670-215835692 AAAGAGGAGGAGAGAGGGTAGGG - Intronic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921717887 1:218437029-218437051 AGATATAAGCAGAGAGTGGCTGG - Intronic
921973692 1:221178079-221178101 GAAGAGAAGAAGAGAGGTGAAGG + Intergenic
921983334 1:221282678-221282700 AAATAAAAGAAGAGAGTGGGAGG - Intergenic
922297724 1:224266232-224266254 AGAAAGAAGCAGAGAGAGGGGGG - Intronic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922724032 1:227914364-227914386 AAAGAGGAGGAGGGAGAGGAGGG - Intergenic
922772794 1:228196992-228197014 AGACAGAGGCAGAGACTGGAGGG - Intergenic
922914985 1:229249907-229249929 AGAGAGAAAGAGAGAGAGGAAGG - Exonic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923667804 1:236014214-236014236 AAAGAGAGAGAGAGAGTTGAGGG - Intronic
923695997 1:236252827-236252849 TAAGAAAAGCAGAAAGTGAAAGG + Intronic
923718446 1:236447118-236447140 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
923839207 1:237649851-237649873 AAAAAGAATCAGAGAGTAGAAGG - Intronic
924014462 1:239705383-239705405 ATAAAGTAGCAGAGACTGGAAGG + Intronic
924027313 1:239847929-239847951 AAAGAGAAGAGAAGAGAGGAGGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924695756 1:246397932-246397954 AAAGAAAAGAGGAGAGGGGAGGG + Intronic
924701629 1:246459524-246459546 ACAGAGCAGGAGAGAGTGAAGGG - Intronic
924754956 1:246932127-246932149 AAAGAGAAGCAGGGCCTGGAAGG + Intergenic
924859241 1:247904432-247904454 AAAGACCAGCAGAGAGAGAACGG - Intergenic
1062802324 10:389391-389413 AAAGAGGGGAAGTGAGTGGAGGG - Intronic
1062945472 10:1457996-1458018 AAAGAGCAGGAGAGAAAGGAGGG - Intronic
1062948122 10:1476186-1476208 AGAGAGAGGCAGAGAGAGAAAGG + Intronic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063297227 10:4818910-4818932 AAAGAGAAGTAGAGAGGAAATGG + Intronic
1063312671 10:4969244-4969266 AAAGATGACCAGAGAATGGATGG + Intronic
1063315265 10:4998302-4998324 AAAGATGACCAGAGAGTGGACGG - Intronic
1063365192 10:5486346-5486368 AAAGGGAAGGAGGGAGAGGAGGG + Intergenic
1063426453 10:5953664-5953686 CAAGAGAAGGAGAGAGTGACTGG + Intronic
1063453412 10:6166421-6166443 AAATAGATGCATTGAGTGGAAGG - Intronic
1063680492 10:8182757-8182779 AAAGAGAAAAAGAAAGTAGAGGG - Intergenic
1063790985 10:9447534-9447556 AAAGACAGGGAGAGAGAGGAAGG - Intergenic
1064112017 10:12547652-12547674 AAAGAGAGAGAGAGAGTGCAGGG - Intronic
1064185615 10:13159364-13159386 AGAAGGAAGCAGAGAGGGGATGG - Intergenic
1064273486 10:13885894-13885916 AGAGAGAAGGAGAGATGGGAGGG - Intronic
1064425517 10:15225982-15226004 AAAGAGAAGCTCAGGGTGAAGGG - Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064896371 10:20241907-20241929 AAATAGAATCAGACACTGGATGG + Intronic
1065169243 10:23010628-23010650 AAAGGGAAGGAGAGAGAAGATGG - Intronic
1065223001 10:23515018-23515040 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1065254366 10:23850857-23850879 AAAAGGAAGAAGAGAGTGAAGGG + Intronic
1065258481 10:23899939-23899961 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1065289069 10:24212095-24212117 AAAAAAAAGAAGAGAGAGGAGGG + Intronic
1065497231 10:26341872-26341894 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065497261 10:26342007-26342029 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065656712 10:27959161-27959183 AAAGAGGAGAGGAGAGGGGAGGG + Intronic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1065853117 10:29807331-29807353 AAAGAGATGGAGAGAGAGAAAGG + Intergenic
1065876289 10:30000210-30000232 AAAGAGGAGCAGAGAGAGGGAGG - Intergenic
1065957556 10:30706452-30706474 AAAGAGAAAGAAAGAGAGGAGGG - Intergenic
1066148401 10:32587395-32587417 AGAGAGCAACAGAGAGAGGAAGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066369814 10:34811078-34811100 AAGGGGAAGGAGAGAGTGAAGGG - Intronic
1066382576 10:34913732-34913754 AAAGAGAGGAGGAGAGGGGAGGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067434914 10:46270036-46270058 AAAGAGGAGCTGAGAGGGGCAGG + Intergenic
1067807882 10:49405819-49405841 GAAGGGAAGGAGGGAGTGGAGGG - Intergenic
1068075581 10:52249096-52249118 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068477217 10:57543206-57543228 AAAGAGAAGGAAAGAGAGAAAGG + Intergenic
1068640174 10:59395694-59395716 AAAGAGCAGCAAAGAGCAGAAGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069249308 10:66247209-66247231 AAGAAGAAGTAGAGAATGGAAGG + Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1069920193 10:71811688-71811710 GGAGAGAAGCAGAGAGGGGCTGG - Intronic
1070211059 10:74322733-74322755 AAAGGGAAGAAGAGAGAGAAAGG - Intronic
1070441518 10:76450817-76450839 AAAGAGAATCAGAGTGTCAAAGG - Intronic
1070728427 10:78808230-78808252 AAAGATAATGAGAGAGCGGAGGG - Intergenic
1070762118 10:79030350-79030372 AAAGAGAAGAAAAGGATGGAGGG - Intergenic
1070852768 10:79581243-79581265 AAAGAGAAACAGAAAGGGAAAGG + Intergenic
1070867620 10:79715989-79716011 ACAGAGAAGAAGAGAGTGTTTGG - Intergenic
1071428029 10:85579395-85579417 ACAGAGAAAGAGAGAGGGGACGG + Intergenic
1071634533 10:87238214-87238236 ACAGAGAAGAAGAGAGTGTTTGG - Intergenic
1071660712 10:87499808-87499830 ACAGAGAAGAAGAGAGTGTTTGG + Intergenic
1071748681 10:88450670-88450692 AAAGAGAAGAAAAGGATGGAAGG + Intronic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072073948 10:91949737-91949759 AAAGAGAGCCAGAGAGAAGAGGG - Intronic
1072580916 10:96739722-96739744 AAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1072610583 10:97014873-97014895 AAAAAAAAGCCTAGAGTGGAAGG + Intronic
1073192382 10:101660972-101660994 AGAGAAAGACAGAGAGTGGAAGG + Intronic
1073505008 10:103977997-103978019 AAAGAGAAACAGATAATGAATGG - Intronic
1073552983 10:104420707-104420729 AAAGAGAAAAAGAAAATGGAAGG - Intronic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1073862323 10:107761211-107761233 AAAGAGAAGAAAAGAGTGGGAGG + Intergenic
1073866498 10:107810371-107810393 TAAGAGAAGATGAGAGAGGAAGG - Intergenic
1073931115 10:108578232-108578254 AAATAGAAGCAGATTGTGGGTGG + Intergenic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1074756740 10:116629384-116629406 AGAGAGAAACAGAGCGTGGGAGG - Intronic
1074966565 10:118495937-118495959 AAAGAGAATCACAGAGTAGAAGG + Intergenic
1075010830 10:118868893-118868915 AGTGTGAAGCAGAGAGTAGATGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075629776 10:123994092-123994114 GAAGAGAGGCAGAGAGGAGACGG + Intergenic
1075923152 10:126229700-126229722 AAGGAGAAAGAGTGAGTGGAAGG - Intronic
1076239924 10:128897083-128897105 CAAGAGAGGGAAAGAGTGGAAGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077300631 11:1845322-1845344 ACAGAGAAGCAGAGAGACAAAGG + Intergenic
1077355440 11:2114669-2114691 AATCACAAGCAGAGAGTGGCGGG + Intergenic
1077706393 11:4490295-4490317 AAAGAGTGGCAAAGGGTGGAGGG - Intergenic
1077772532 11:5235610-5235632 AAAGAAACGAAGAGAGGGGAAGG + Intergenic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078108113 11:8371320-8371342 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078416067 11:11166045-11166067 AAAGAGAAAGAGAAAGTGCAAGG - Intergenic
1078459227 11:11500713-11500735 AAAGAGAAGTAAGGAGAGGAGGG - Intronic
1078605906 11:12775340-12775362 AGAGGGAAGTAGAGAGTGGGTGG + Intronic
1078666309 11:13328522-13328544 AAAGCCAGGCAGGGAGTGGAGGG - Intronic
1078678613 11:13452095-13452117 AAAGAGATTCAGAGACAGGAGGG + Intronic
1078876946 11:15408691-15408713 AGAGAGAGGCAGACACTGGAGGG + Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079418919 11:20267942-20267964 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1079517641 11:21287971-21287993 AAAGAAAAGAAGAGAATAGAAGG + Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1079694898 11:23469272-23469294 AAAGAAAAGGGGAGAGGGGAAGG + Intergenic
1079804500 11:24912148-24912170 AAAGAGGAGGAAAGAGAGGAAGG - Intronic
1079913628 11:26341080-26341102 GAAGAGAAGCGGGGAGGGGAGGG - Intronic
1080274257 11:30486023-30486045 AAAGAGGAGCACCCAGTGGAAGG + Intronic
1080312786 11:30913573-30913595 AAAGAGAGGCAGTTAGTGGAAGG - Intronic
1080321389 11:31014234-31014256 AAAGAGAGGAAGGGAGGGGAGGG - Intronic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080635458 11:34119502-34119524 AAAGAGAAGGAGTGAGTGATAGG + Intronic
1080830443 11:35888939-35888961 GAGGGGAAGCTGAGAGTGGATGG - Intergenic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1081000929 11:37669928-37669950 AAAGAGAGACAGAGAGAGAATGG - Intergenic
1081463265 11:43291207-43291229 AAAGAGAATCAGAGACAGGGAGG + Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1081699558 11:45144577-45144599 AAAGAGAAGTAGATAAAGGAGGG - Intronic
1081747228 11:45481784-45481806 AAAGAGAGCCAGAGAAAGGAAGG - Intergenic
1081789956 11:45775532-45775554 GAAGGGAGGCAGAGAGGGGAGGG - Intergenic
1082212111 11:49517778-49517800 AGAGAGTGGCATAGAGTGGAGGG - Intergenic
1082223911 11:49677728-49677750 AAAGAGAAGAGGGGAGGGGAGGG - Intergenic
1082660978 11:55910962-55910984 TTAGAGAGACAGAGAGTGGAAGG + Intergenic
1082869968 11:57935240-57935262 AAAGAGGCCCAGAGAGGGGAAGG + Intergenic
1082937774 11:58672276-58672298 AAGGTGAAGCAGGGACTGGAAGG - Intronic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083177202 11:60957994-60958016 AAAGAGAACAAGAGAGAGAAGGG + Intergenic
1083519275 11:63292667-63292689 AAAGAGAAGTGGAGGGTGAAGGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084514642 11:69629913-69629935 GAAGACAGGCAGAGATTGGAAGG - Intergenic
1084618056 11:70249657-70249679 AGACAGAAGCAGAGACTGTAGGG - Intergenic
1084759196 11:71257702-71257724 AGAGAGAAGGAGAGAAGGGAAGG + Intergenic
1084886000 11:72207291-72207313 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1085259203 11:75194564-75194586 AAAGAGGGGCAGAGAATGAAAGG - Intronic
1085328182 11:75624619-75624641 AAAGAGAAGCAGAAAATTCAAGG - Intronic
1085800234 11:79582594-79582616 CAAGAGAAGCAGAGCTTAGAAGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086202306 11:84218322-84218344 AAAGAGAAGGAAAGAAGGGAAGG + Intronic
1086325980 11:85699882-85699904 AATGAGACCCTGAGAGTGGAGGG + Intronic
1086474473 11:87156297-87156319 AAAAAGAAGAAGAAAGTTGAAGG - Intronic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087781342 11:102304091-102304113 GAGGAGAAAGAGAGAGTGGAAGG + Intergenic
1087876064 11:103359415-103359437 GAAGAGAAGCAGTTAGTGCAAGG - Intronic
1087903244 11:103666284-103666306 CAAGAGAGGCAGAGTGTGCAGGG - Intergenic
1087997017 11:104821884-104821906 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
1088227069 11:107632852-107632874 AATGAGAACAAGAGAATGGATGG - Intronic
1088517859 11:110657905-110657927 AAAGAAAAAGAGAGAGAGGAAGG + Intronic
1088670962 11:112140245-112140267 AAAGAGAAAGAGAGAGAGGGAGG - Intronic
1088743636 11:112786648-112786670 AAGGAAAAGCAGAGACTGGCTGG + Intergenic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1088909772 11:114182011-114182033 AAAGATAAACAGAGAGTGCCAGG - Intronic
1088911739 11:114197428-114197450 AGAGAGAAACAGAGAGTGGGGGG - Intronic
1088926392 11:114307510-114307532 ACAGAGAAGAATTGAGTGGAGGG - Intronic
1089134775 11:116240358-116240380 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1089148097 11:116345086-116345108 AAAAAGAAGCAAAGACAGGAAGG + Intergenic
1089187677 11:116631292-116631314 AGAGGGAAGCAGAGGGTGGCTGG - Intergenic
1089361175 11:117887695-117887717 AAAGAGAGACAGAGAGGGCAGGG - Intergenic
1089418921 11:118316360-118316382 AAAGAGAGAGAGAGAGTGAAGGG + Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1089558533 11:119330575-119330597 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1089562537 11:119351504-119351526 AAAGAGGAGAGGAGAGGGGAGGG - Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089894802 11:121919347-121919369 AAAGAGATGCACTGAGGGGAGGG + Intergenic
1090055778 11:123423340-123423362 GAAGAGAAGAGGAGAGAGGAGGG - Intergenic
1090128430 11:124115009-124115031 AAAGATAAGGAGATAGTGCAAGG - Intergenic
1090385064 11:126353307-126353329 AAAGACAAGAAGAGAGAGAAAGG + Intergenic
1090488041 11:127132269-127132291 AAACAGAAAAAGAGAGTGGAAGG - Intergenic
1090516967 11:127438941-127438963 AAAGAAAAGAAGAGCTTGGAGGG - Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1091030831 11:132186321-132186343 CAAGGGAAGCAGGCAGTGGATGG + Intronic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091451758 12:576409-576431 AAACGGAAGCAGAGTGTGTAGGG + Intronic
1091633838 12:2182606-2182628 AAAGGAAAGGAGAGAGTGTAGGG - Intronic
1091690324 12:2591894-2591916 AGACAGAGGCAGAGATTGGAGGG - Intronic
1091988381 12:4933000-4933022 TAAGAGAGGCAGAAAATGGATGG - Intergenic
1092025665 12:5237702-5237724 ACAAAGACCCAGAGAGTGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092597399 12:10022470-10022492 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
1092626040 12:10330039-10330061 AAGGAGAAGCTGAGAGTTAAAGG + Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092847398 12:12596505-12596527 AAAGAGAGGCAGAGAGAGAGAGG - Intergenic
1092893703 12:12993162-12993184 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1092941061 12:13407633-13407655 AGACAGAGGCAGAGACTGGACGG - Intergenic
1093107488 12:15106158-15106180 AAAGAGAAAGAGAGAAAGGAAGG - Intergenic
1093228221 12:16511736-16511758 AAAGAAAAGAAGAGAGGGGCTGG - Intronic
1093331795 12:17852500-17852522 AATGAGAAGCAGAGAGACAAGGG + Intergenic
1093407803 12:18826345-18826367 ACATAGAAGCAGAGAGTAGCAGG - Intergenic
1093804291 12:23412736-23412758 AAAGAGATCCAGATAATGGAAGG - Intergenic
1094079386 12:26516153-26516175 AAAGAGAAGGGGAGAGGAGAGGG + Intronic
1094226860 12:28055721-28055743 AAAGAGAAAGAGAGAGAGAAAGG + Intergenic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1094594804 12:31855498-31855520 AAAGAGAAGCAAGCAGTGCAGGG - Intergenic
1094698656 12:32846756-32846778 AAAAAAAAGAAGAGAGAGGAAGG + Intronic
1094708784 12:32940708-32940730 AGAGAGAGAGAGAGAGTGGAGGG - Intergenic
1094804895 12:34080148-34080170 AAAAAAAAGAAGAGGGTGGATGG + Intergenic
1095116902 12:38365078-38365100 AAAAAAAAGACGAGAGTGGATGG + Intergenic
1095177162 12:39106221-39106243 AAGGAGAAAGAGAGAGTGAAGGG + Intergenic
1095385523 12:41645712-41645734 AAAGAGAAAGAGAGAGAAGAGGG + Intergenic
1095528853 12:43160845-43160867 AAGGAGAAAGAGAGAGTGAAGGG - Intergenic
1095596929 12:43969875-43969897 AAAGAGAGGAGGAGAGTGAATGG - Intronic
1095710435 12:45282347-45282369 AAAGAGGAGCAGGGCTTGGATGG + Intronic
1095808083 12:46343209-46343231 AAAGGGGAGAAAAGAGTGGAAGG - Intergenic
1095978997 12:47959818-47959840 GCAGAGCAGCAGAGAGTGAAGGG - Intergenic
1096013348 12:48243052-48243074 AAAGAGAAGCTGAGAGTCCTTGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096368074 12:51045472-51045494 AAAGAGAAAGAAAGAGAGGAAGG + Intergenic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1096571985 12:52528804-52528826 GGAGAGAAGCAGGGAGAGGAGGG - Intergenic
1096695504 12:53345744-53345766 AAAGAGAAGCAGATAGGCAAGGG + Intergenic
1096830877 12:54313142-54313164 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1097500550 12:60395294-60395316 AGAGAGAACCAGAGAATGCAGGG - Intergenic
1097579481 12:61436539-61436561 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1097596299 12:61636381-61636403 AAAAAGAGGCAGATATTGGAGGG - Intergenic
1097771502 12:63591963-63591985 AAAGAAAAGAAAAGAGGGGAAGG + Intronic
1097793211 12:63836965-63836987 AAAGACAGGCAGAGAGAGAAAGG - Intergenic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098109085 12:67102644-67102666 AGAGAGATGCAGAGAGAGGGAGG - Intergenic
1098170878 12:67745917-67745939 AAAGAGAAACAGACAGAGAAGGG - Intergenic
1098194695 12:67987336-67987358 AAAGAGAGAGAGAGAGTGAAGGG - Intergenic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098285389 12:68901879-68901901 AGAGAGAAGGGGAGAGGGGAGGG + Intronic
1098460766 12:70730810-70730832 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1098652853 12:72995610-72995632 AAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1098704275 12:73666767-73666789 AAAGAGAGGAAGAGAATGCAAGG - Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099048643 12:77755653-77755675 AAAGAAAGAGAGAGAGTGGAAGG - Intergenic
1099101787 12:78450556-78450578 AAAAAGAAGAGGAGAGAGGAAGG + Intergenic
1099171740 12:79372802-79372824 AGAGATAAGAAGAGAGGGGAGGG - Intronic
1099173708 12:79396461-79396483 CAAGAGAAGCAGTTAGTTGAAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099230254 12:80014920-80014942 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1100162498 12:91876465-91876487 TAAGAGAAATAGAGAGAGGAAGG - Intergenic
1100375557 12:94013179-94013201 GAAGAGAAGAGGAGAGGGGAGGG + Intergenic
1100522039 12:95384505-95384527 AAAGAAGAGAAGAGAATGGAGGG - Intergenic
1100767556 12:97884593-97884615 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1100915610 12:99417487-99417509 AAAGAGAAGAAAAAAGTGGGAGG - Intronic
1101034834 12:100694874-100694896 AAAGAGGAGAGGAGAGGGGAGGG - Intergenic
1101263085 12:103053862-103053884 AAAGTGAAAAAGAGACTGGATGG - Intergenic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101693024 12:107098401-107098423 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102194730 12:111016931-111016953 AGAGAGAAGAAGAGAAGGGAGGG - Intergenic
1102501045 12:113352577-113352599 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1102523528 12:113494347-113494369 GAAGAGAAGAAGAGAGGTGAGGG + Intergenic
1102558048 12:113741919-113741941 AAAGAGATGGAGAGAGAGAAGGG + Intergenic
1102838311 12:116088724-116088746 AAAGAAAAGAGGAGAGGGGAGGG + Intronic
1102868604 12:116394334-116394356 AGACAGAAGCAGAGATGGGAGGG - Intergenic
1102933448 12:116879254-116879276 AATGAGAAGGAAAGAGAGGAAGG - Intronic
1103000727 12:117383553-117383575 AAAGCGAAGGAGAAAGTCGAGGG + Intronic
1103018371 12:117513732-117513754 AAAGAGGACGAGAGAGTGGATGG + Intronic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1103461760 12:121110580-121110602 AAACTGAGGCAGAGAGTGGAAGG + Intergenic
1104024400 12:125015341-125015363 AATGAGAAACAGGGACTGGAGGG + Intronic
1104371877 12:128230696-128230718 AAAGACAACCAGAGAGAGGAGGG + Intergenic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104590515 12:130081004-130081026 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1105373235 13:19819247-19819269 AAAGTGAAGTAGTGAGAGGAGGG + Intergenic
1105434842 13:20367564-20367586 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
1105992218 13:25633438-25633460 AAAGAGAGCAAGAGAGTGCATGG + Intronic
1106001356 13:25726552-25726574 CAACAGAAGCAGAGAATGAAGGG - Intronic
1106254619 13:28011321-28011343 AAAGAGGAGAGGAGAGGGGAGGG + Intronic
1106262128 13:28077028-28077050 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1106816118 13:33408995-33409017 AAAGAGAGGCAGAGAGAGAATGG - Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1106951200 13:34885694-34885716 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1106965774 13:35064924-35064946 AAAAAGAATCAGAGGCTGGATGG - Intronic
1107219186 13:37961118-37961140 AAAGAGAAGGGGAGATTGGTTGG - Intergenic
1107403900 13:40095435-40095457 CATGAGAAGCAGGGACTGGATGG + Intergenic
1107767922 13:43757193-43757215 AAAGAGGAGCAGAGAATTGAGGG - Intronic
1107850936 13:44573218-44573240 AAAGAGAAGCAGAGGCTGCTAGG + Exonic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108687022 13:52828529-52828551 AAATAGATGCAAACAGTGGAGGG - Intergenic
1108800579 13:54090828-54090850 AAAGAGAAGGAGAGAGACCAAGG - Intergenic
1108869860 13:54970794-54970816 AAAGAGAAATAGACATTGGAAGG + Intergenic
1108870924 13:54984972-54984994 AAAGAGATGGAGAGACTTGATGG + Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109162124 13:58988617-58988639 AGAGAGAAAGAGAGAGTGAAAGG - Intergenic
1109202122 13:59441938-59441960 AAAGAGGAGCATGGATTGGAAGG + Intergenic
1109241985 13:59900836-59900858 CAAGAGAAGCAGATTATGGAAGG - Intronic
1109470086 13:62792390-62792412 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109580367 13:64323567-64323589 TAAGATACACAGAGAGTGGAAGG + Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1109665831 13:65535304-65535326 AAAGAGAACCATAGATTTGATGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110263843 13:73516071-73516093 AAAGAGAAGAAAAGCCTGGAGGG - Intergenic
1110279460 13:73675937-73675959 ACAGAGGGGCAGAGAGTGGCAGG + Intergenic
1110514348 13:76392237-76392259 AAATATAAGCAGAGAGTAGAAGG + Intergenic
1110538636 13:76682174-76682196 AGAGAAAAGCAGAGAGTAGGTGG - Intergenic
1110938391 13:81319830-81319852 AAAGAGGAGTTGAGAGTGGCAGG + Intergenic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111449769 13:88399692-88399714 AATGTGAAGTAGAGAATGGAAGG - Intergenic
1111514734 13:89314183-89314205 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1111664098 13:91245498-91245520 CAAGAGCAGCAGAGTGTGGTTGG - Intergenic
1111675242 13:91378863-91378885 AAAGAAAAGGAAAGAGAGGAAGG + Intergenic
1111918092 13:94382642-94382664 AAAAAGCAACAGAGGGTGGAGGG + Intronic
1112039621 13:95533826-95533848 AGAGAGAAGATCAGAGTGGAGGG - Intronic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112194403 13:97210977-97210999 AAAGGGTAGCAGGGAGAGGAAGG + Intergenic
1112554246 13:100452148-100452170 AAAGAGAAGGAGAGAGGGAGAGG - Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112716207 13:102189079-102189101 AAAGAGAAAGAGAGAAAGGAGGG + Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113058079 13:106290840-106290862 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1113108817 13:106799870-106799892 TAAGAGAAAAGGAGAGTGGAAGG + Intergenic
1113110205 13:106814476-106814498 AAAGAAAAAGAGAGAGAGGAAGG + Intergenic
1113346613 13:109484084-109484106 AAACACAAGCAGCGAGTGGCAGG + Intergenic
1113464904 13:110506251-110506273 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113464911 13:110506300-110506322 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114046735 14:18882031-18882053 AAACAGCACCAGAGAGGGGAAGG - Intergenic
1114117478 14:19637416-19637438 AAACAGCACCAGAGAGGGGAAGG + Intergenic
1114152456 14:20059089-20059111 GAAGAGAAGGAGAGAGATGAGGG + Intergenic
1114174363 14:20306666-20306688 AAAGAGCAGAAGTGAGTGGCTGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114388504 14:22280726-22280748 AAAGAGAAGGAAAGACGGGAAGG + Intergenic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114805785 14:25834972-25834994 AAAAAGAAGTACAGAGAGGAAGG - Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115117113 14:29894454-29894476 AAAGAAAGGCAGATAATGGATGG + Intronic
1115211025 14:30967248-30967270 GAAGAGAGGCAGAGAGAGGGGGG + Intronic
1115271718 14:31560271-31560293 AGAAAGAAGAAGAGAGTAGAAGG - Intronic
1115305727 14:31931652-31931674 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1115308232 14:31953819-31953841 GAGGAGAAGCAGAGAGTTGGGGG - Intergenic
1115934881 14:38541155-38541177 AAAGAGCAGCATAGAATGCATGG - Intergenic
1116002930 14:39263614-39263636 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116699724 14:48224578-48224600 AAAGAAAAGGAGAGAGGGAAGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1116949713 14:50868055-50868077 GAAGAGAAGCAGAGCTAGGAAGG + Intronic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117325435 14:54664602-54664624 AGAGAGAAGAAGAGAGGGGGTGG - Intronic
1117333610 14:54737761-54737783 AAAGAGAAGAGGAGAGAGAAAGG - Intronic
1117356492 14:54928722-54928744 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1117539128 14:56729569-56729591 AGCGAGAAGCAGAGAGTGTATGG + Intronic
1117564704 14:56981281-56981303 AATGTGAAGCAGAGATAGGATGG - Intergenic
1117859264 14:60073171-60073193 AAAGAAAAGCAGGGGGTGGCTGG + Intergenic
1117970210 14:61244076-61244098 AAACAGGAGCATAGAGTAGAAGG + Intronic
1118205610 14:63720366-63720388 AAAGAGACGGAGGGAGGGGAAGG + Intronic
1118219469 14:63841402-63841424 AAATGGAGGCAGAGAATGGAAGG - Intergenic
1118422330 14:65620678-65620700 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1118925037 14:70184504-70184526 AAAGAGGAGAGGAGAGTGGAGGG - Intronic
1119131341 14:72175827-72175849 AAAGGGAGGAAGAGAGGGGAAGG + Intronic
1119374782 14:74181138-74181160 AAAGAAAAGGAAAGAATGGAAGG + Intronic
1119484019 14:74976839-74976861 AAAGAGCAGCTGTGAGTGGCAGG + Intergenic
1119739867 14:77007474-77007496 AAACAGAAAAAGAGAGTGGGCGG + Intergenic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1119963776 14:78889979-78890001 AGACAGAGGCAGAGATTGGAGGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1120238504 14:81921702-81921724 AAAGAGAAGAATAAAGTGGGAGG + Intergenic
1120360171 14:83490476-83490498 AAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1120389870 14:83892431-83892453 AAAGATTAACAGAGAGTAGAGGG + Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120677894 14:87443345-87443367 AAAGAGAAACAGTGAGTGGGAGG + Intergenic
1120722530 14:87904387-87904409 AAAGAGAAACACAGGGTGGGAGG + Intronic
1121489818 14:94349766-94349788 ACAGAGAAGCTGAGAAGGGAAGG + Intergenic
1121524940 14:94613218-94613240 AAAGGGGAAGAGAGAGTGGAAGG - Intronic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121697961 14:95928341-95928363 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
1121895536 14:97643556-97643578 AAAGAGAAAGAGAGTGTGTAGGG - Intergenic
1121902713 14:97708578-97708600 AAACAAAAGGAGAGAGGGGAGGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122412448 14:101532690-101532712 GAAGACAGGCAGAGACTGGAGGG + Intergenic
1122448187 14:101782997-101783019 GAAGAGAAAGAGAGAGGGGAGGG - Intronic
1122552766 14:102558917-102558939 AAAAAGAAGCAGGCAGTGGGTGG - Intergenic
1122823151 14:104357084-104357106 AGATGGAAGCAGAGACTGGAAGG + Intergenic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1123570376 15:21600695-21600717 AAAGAAAAGAAGAGAAGGGAAGG - Intergenic
1123771453 15:23533902-23533924 CAAAAGAGGCAGAGAGTGGTCGG + Intergenic
1124037233 15:26065833-26065855 AAAGAGAAGCAGAGAGGAACTGG - Intergenic
1124153338 15:27202076-27202098 AGATAGAAGCAGAGAGGAGATGG - Intronic
1124363814 15:29057343-29057365 AATGAGTAGAAGAGAGGGGAGGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125157500 15:36604960-36604982 AAAGAGAAGCACAGAGGACAAGG - Intronic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125848874 15:42885402-42885424 TAAGAGAAGGAGAGATTGAAGGG - Intronic
1126011242 15:44304540-44304562 AAATAGAAGTAGAGCCTGGAGGG - Intronic
1126049822 15:44675606-44675628 AAAAAGAAGAAGAGAATGAAGGG - Exonic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126224157 15:46250460-46250482 AGAGAGAGACAGAGAGAGGAGGG + Intergenic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126393260 15:48182079-48182101 AAAGAGAAGAAGAGAGAGAATGG - Intergenic
1126401966 15:48281162-48281184 AAAGTGAAACACAGAGAGGATGG - Intronic
1126443263 15:48714916-48714938 GAAGAGAAGAGGAGAGGGGAAGG - Intronic
1126685225 15:51242530-51242552 AAAGCACAGCACAGAGTGGAAGG + Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126744537 15:51812852-51812874 AAAGGGAAGCTGCAAGTGGAAGG - Exonic
1126868380 15:52960876-52960898 AAAGAGAAGAACAAAGTAGAAGG - Intergenic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127462343 15:59211046-59211068 AAAAAGAAGCTGAGTGTGGTGGG + Intronic
1127559911 15:60125862-60125884 AAAGAGAGACAGAGAGAGGTTGG + Intergenic
1127946138 15:63755796-63755818 AAAGAGAGGAAGAGAGAGGAGGG + Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128557460 15:68641449-68641471 AAAGAAGGGCAGAGAGTGGGAGG + Intronic
1128710669 15:69869115-69869137 AAAGAGAAGTGGGGAGGGGAAGG - Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129326832 15:74804413-74804435 GAAGAGATGCTGAGACTGGAGGG + Intergenic
1129661167 15:77553893-77553915 AAAGAGAAGCAGAGAGGCAGGGG + Intergenic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1131015414 15:89053696-89053718 CAAGAGAAGCAGAGACTCAAGGG + Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131111026 15:89765629-89765651 AAAGAGGAGAGGAGAGGGGAGGG + Intronic
1131320294 15:91382934-91382956 AAAAAGAAGCAAAGAGAGGGAGG + Intergenic
1131863147 15:96676110-96676132 AGAGTGAAGCAGAGAATGGTAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131899124 15:97068581-97068603 AAAGAAAAGAAAAGAGAGGAAGG - Intergenic
1132141349 15:99399290-99399312 AGAGAAAAGAAGAGAGTGGTGGG + Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132818467 16:1847592-1847614 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
1133050516 16:3114840-3114862 AGAAGGAAGCAGAGACTGGAGGG - Intronic
1133282236 16:4673361-4673383 AAAGAGAAGTCCAGAGGGGAGGG - Intronic
1133421492 16:5650694-5650716 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1133476851 16:6131838-6131860 ACAGAGAGCCAGAGAGTGGCAGG - Intronic
1133485579 16:6215312-6215334 AGAGAGAGACAGAGAGGGGAGGG + Intronic
1133565188 16:6986678-6986700 AGAGAGAAGGAGAGAGAGAAGGG - Intronic
1133855574 16:9546417-9546439 AAAGTAAAGCAGAGTATGGAAGG + Intergenic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1134110985 16:11515562-11515584 AAAGAGGAGAAGGGAGGGGAAGG + Intronic
1134316970 16:13127533-13127555 AAAGAGAAGCGGAACTTGGAAGG + Intronic
1134604749 16:15561563-15561585 AGAAAGAAGCAGAGAATGGCTGG - Intronic
1134853795 16:17503103-17503125 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1135066558 16:19314969-19314991 AGAGGGAAGAAGAGAGAGGAAGG + Intronic
1135088093 16:19490792-19490814 AAAGAGAGGGAGGGAGGGGAAGG - Intronic
1135663031 16:24313008-24313030 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1135683674 16:24480205-24480227 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135836236 16:25828165-25828187 AAAGAGAAAGAGAGAGAGAAAGG - Intronic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1135954338 16:26943623-26943645 TAAGAGAAGTAGAGAATGCATGG - Intergenic
1136003962 16:27315609-27315631 AAAGGGAGGCACAGAGTGGGCGG + Intronic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136080978 16:27852505-27852527 ATATAGCAGCTGAGAGTGGAAGG + Intronic
1136136876 16:28261633-28261655 AAAGAGAAAGAGAGAGGGCATGG + Intergenic
1136405659 16:30045126-30045148 AAAGATAAGCACAGAGAGAAAGG + Intronic
1136464966 16:30436424-30436446 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1136507374 16:30713484-30713506 AGAGAGAATCAGAGAGAGTATGG - Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136619883 16:31421541-31421563 AAACAGAAGCATAGAGAGAAGGG + Intronic
1136657617 16:31719982-31720004 AAACAGAAGAAGAGAGAGAAAGG + Intronic
1136926834 16:34382020-34382042 AAAGAAGAGAAGAGAGGGGAGGG + Intergenic
1136977740 16:35029787-35029809 AAAGAAGAGAAGAGAGGGGAGGG - Intergenic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137505868 16:49053169-49053191 AAAGAGAAAGAAAGAGTGGCCGG - Intergenic
1137598850 16:49742821-49742843 GAAGAAAAGCAGGGAGAGGAGGG + Intronic
1137689753 16:50414687-50414709 AAAGAGACAGAGAGAGAGGAAGG - Intergenic
1137796883 16:51228531-51228553 AAAGAGGAGAGGAGAGGGGAGGG + Intergenic
1137929780 16:52576012-52576034 AAAGAGAGGAAGAGAGAGGAAGG + Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138036086 16:53608093-53608115 ACTGAGAAGTAGAGAGTGGCAGG - Intronic
1138094405 16:54200788-54200810 AAAGAGAAGGAGAGAGTTTAGGG - Intergenic
1138103595 16:54274464-54274486 AGAGAGAATAAGAGAGAGGAAGG - Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138238629 16:55407686-55407708 AGAGCGGGGCAGAGAGTGGATGG + Intronic
1138755275 16:59476502-59476524 AGAGAGAGACAGAGAGGGGAGGG - Intergenic
1138983369 16:62297310-62297332 AAAAAAAAGAAGACAGTGGAAGG + Intergenic
1139340134 16:66263047-66263069 AGACAGAGGCAGAGATTGGAGGG - Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139924531 16:70478866-70478888 AACAGGAAGCAGAGAGGGGAAGG + Intronic
1140140835 16:72256021-72256043 AAAGAATAGCAGAAAGTTGATGG + Intergenic
1140230276 16:73112214-73112236 ACAGAGAAGAAGAGAGGGGTGGG + Intergenic
1140243152 16:73222771-73222793 AAAGAGAAGAAAAGAGCTGAAGG + Intergenic
1140724440 16:77799333-77799355 AAAGAGATGGAGAAAGTGGGAGG - Intronic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1141109316 16:81258936-81258958 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141738395 16:85871628-85871650 AAAGAGAAACAGAGAAAGAAAGG - Intergenic
1141752620 16:85969131-85969153 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1141927401 16:87178520-87178542 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141927409 16:87178553-87178575 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1142652855 17:1367657-1367679 AAAGAGAAGAGGAGACGGGAGGG + Intronic
1143114587 17:4575556-4575578 ACAGAGAAACAGAGACTGGGAGG + Intergenic
1143124204 17:4631357-4631379 AAAGAGGAAGAGAGAGAGGAAGG + Exonic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143184668 17:5003019-5003041 AAAGACAAGCAAACAGTAGAGGG - Intronic
1143266651 17:5642990-5643012 AAAGAGAAGAGAAGAGGGGAAGG - Intergenic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143394681 17:6583512-6583534 AAAGTGAAGAAGAGAGGGAAAGG - Intronic
1143486259 17:7256480-7256502 AAAGGGAGGCAGAGAATTGAAGG + Intronic
1143731322 17:8884542-8884564 TGAGAGAAGCAGAGAAGGGAAGG - Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144079117 17:11746302-11746324 AAAGAGAGAGAAAGAGTGGAGGG + Intronic
1144132880 17:12265101-12265123 AAAGAGAAGGAGAGAGTATTTGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144343359 17:14329408-14329430 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1145376060 17:22350055-22350077 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1145992826 17:29089497-29089519 AAAAAAAAGCAGAGACAGGAGGG + Intronic
1146410683 17:32581532-32581554 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1146431510 17:32800503-32800525 TAATAGAAGTAGAGAGTAGATGG + Intronic
1146552368 17:33792346-33792368 AAAGAGAAGCCGGGAGTGGAGGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146696468 17:34912348-34912370 GAAGAGAAGCAGATAGAGCAAGG + Intergenic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146939863 17:36836891-36836913 AAAGAAAGGCAGAGTGTGGGTGG + Intergenic
1147155938 17:38544538-38544560 ACAGAGAATCAGAGACAGGAAGG + Intronic
1147530201 17:41269190-41269212 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1147597586 17:41726908-41726930 ATAGAGAAGCAATGAGTGGAGGG + Intronic
1147604438 17:41766290-41766312 AAAGAGAGGAAGAGAGGGAAAGG + Intronic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148862220 17:50610321-50610343 TGAGAGGAGCAGAGAGGGGAAGG + Intronic
1149630107 17:58115492-58115514 ACAGAGGAGCATAGAGAGGAAGG - Intergenic
1150091836 17:62333055-62333077 AAAAAGAAGAGGAGAGGGGAGGG + Intergenic
1150115404 17:62544368-62544390 AAAGAGAATGAGAGAGTGAAGGG + Intronic
1150501108 17:65651636-65651658 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1150787679 17:68176055-68176077 AGTGGGAAGCAGAGAGTGGGAGG + Intergenic
1150854707 17:68740917-68740939 ACAGAGAAGCAGAGAAGAGAAGG + Intergenic
1151074165 17:71251960-71251982 AAAGAGAGGAAAAGAGAGGAGGG - Intergenic
1151183206 17:72344522-72344544 AAACAGAAGCAGTGCCTGGAAGG + Intergenic
1151188031 17:72378397-72378419 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1151228521 17:72664766-72664788 GAAGAGAAGAAGAGAACGGAGGG - Intronic
1151228526 17:72664832-72664854 GAAGAGAAGAAGAGAATGGAGGG - Intronic
1151380205 17:73720456-73720478 AAAGAGATGCAGACACTGGCAGG - Intergenic
1151535123 17:74734888-74734910 AAAGGGAAAGAGAGAGAGGAAGG + Intronic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1151892581 17:76959330-76959352 AAAGGGAAGAAGAGAAAGGAAGG - Intergenic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152013098 17:77732315-77732337 AAAGACAAACACAGACTGGAGGG - Intergenic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152466769 17:80471045-80471067 AAACAGAGGATGAGAGTGGAGGG + Intronic
1153006937 18:505248-505270 GAAGAGAAGCTGAGAGTCCAGGG + Intergenic
1153015114 18:576431-576453 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1153135864 18:1917155-1917177 AAAAAGAAGGAAAGAGTGCATGG - Intergenic
1153159190 18:2183588-2183610 AAAAAGAAGCAGAGAAAGAAAGG + Intergenic
1153246153 18:3074293-3074315 AAAGTGGAGAAGGGAGTGGAGGG + Intronic
1153320808 18:3772317-3772339 AGAGAGAAGGAGAGAAAGGAAGG - Intronic
1153502634 18:5764774-5764796 AAGGAGAAGGAGAGAATGAAAGG + Intergenic
1153506486 18:5804388-5804410 AAAGAGAGGGAGAGAGGGCAAGG - Intergenic
1153533299 18:6071833-6071855 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1153559980 18:6362124-6362146 AAAGAGGAGAGGAGAGGGGAGGG + Intronic
1153737111 18:8082538-8082560 AAAAAAAAGCAGAGAGAGAAGGG - Intronic
1154013406 18:10594883-10594905 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154029928 18:10744744-10744766 AAAGAACAGAAGGGAGTGGAAGG - Intronic
1154152579 18:11918146-11918168 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1155449683 18:25950643-25950665 AACAAGAAGAAGAGAGTGGGTGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155940994 18:31801929-31801951 AAAGAGATGAAGGGAGTAGAGGG + Intergenic
1156028200 18:32681545-32681567 AAAAAGAAGCAAAGAGTCAAAGG - Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156087800 18:33428764-33428786 AAAAAGAATTAGGGAGTGGATGG + Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156493978 18:37513733-37513755 AAAGATAAGCAGAAAGTGCTAGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156564471 18:38169730-38169752 AAAGAGAAGGAGAAAGTTAAAGG - Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1156852640 18:41746060-41746082 AAAGAGGAGGGGATAGTGGATGG + Intergenic
1156898745 18:42276257-42276279 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157256024 18:46140411-46140433 AAAGAGAAGGAGAGAAGGAAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157543883 18:48534201-48534223 AAGCAGAAGAAGTGAGTGGAGGG - Intergenic
1157711436 18:49852420-49852442 AAAGAGAGGGAGAGAGAGGGAGG + Intronic
1157925152 18:51756194-51756216 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
1157986302 18:52441840-52441862 AAAAAGAAGAAAAGAGTGGCTGG - Intronic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158161750 18:54492650-54492672 AAAGAGAAGCAGAGATTTATGGG + Intergenic
1158357743 18:56639308-56639330 AAAGAGAAGCAGGGGTTAGATGG + Intronic
1158442133 18:57485690-57485712 ACAAAGAAGCAAAGAGAGGAAGG + Exonic
1158908718 18:62039111-62039133 ACAGAGAAGCAGAGGATTGAAGG - Intergenic
1159151063 18:64523947-64523969 ACAGAGAAGAAGAGAGTGAAGGG - Intergenic
1159289057 18:66392998-66393020 GAAGAGAAGCAGAAATTGCAGGG - Intergenic
1159313119 18:66736174-66736196 AAAGAGAAAGAGAGAAAGGAAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159938152 18:74384951-74384973 TTAGAGAAGCACAGTGTGGAAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160951615 19:1670176-1670198 AAAGAGAGAGAGAGAGGGGAGGG - Intergenic
1161135988 19:2620214-2620236 AAAGAAAAGAGGAGAGGGGAGGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161479306 19:4502718-4502740 AAAGAGAAGCCCCGAGTGGGAGG - Exonic
1161684837 19:5697583-5697605 GAAGAGAGGGAGAGAGAGGAGGG + Intronic
1161696100 19:5769161-5769183 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1161875100 19:6902376-6902398 AAAAAGAGGCACACAGTGGAGGG - Intronic
1161988650 19:7671201-7671223 AAAGAGAAGAGGGGAGAGGAGGG - Intergenic
1161995782 19:7710454-7710476 AAAAAGAATCAGGGAGTGGCTGG + Intergenic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1162977654 19:14217751-14217773 AGAGAGGAGCGGAGAGTTGAGGG + Intergenic
1163024636 19:14503444-14503466 AAAAGGAAGGAGAGAGAGGAAGG - Intergenic
1163067289 19:14807461-14807483 AAAGAGATGAACAGAGGGGAAGG - Intronic
1163175878 19:15563839-15563861 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1163349744 19:16768889-16768911 AAAGAGAAGCAGATAGTTCAAGG - Intronic
1163538627 19:17893433-17893455 GCAGAGAAGCAGAGAAAGGAGGG + Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163776981 19:19224627-19224649 AAAGAGGATCAGAGAGAGGAAGG - Intronic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1164509242 19:28883972-28883994 AAAGAGAAGGAAAGAGAGGAGGG - Intergenic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1164573571 19:29391907-29391929 GCAGACAAGGAGAGAGTGGAGGG - Intergenic
1164692444 19:30221626-30221648 AAGGAGCAGAAGAGAGTGAAGGG + Intergenic
1165021532 19:32928368-32928390 AAAGAGAGAGAGAGAGAGGAGGG - Intronic
1165294266 19:34913578-34913600 AAAGAAAAGCCCAGACTGGATGG - Intergenic
1165322638 19:35095758-35095780 AAAGAAAGGGAGAGAGAGGAAGG + Intergenic
1165331734 19:35144105-35144127 AGAGAGAAGCAGAGAGACGGAGG + Intronic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165698643 19:37920442-37920464 ATAGACAGGCAGAGAGTGCAGGG + Intronic
1165904524 19:39185548-39185570 AAAAAGATGCAGGGAGAGGAGGG - Intergenic
1165991687 19:39818811-39818833 AAAGAGAAGCAGAGACCACAGGG + Intergenic
1166112873 19:40633717-40633739 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1166228700 19:41413066-41413088 ACAGTGAAGCAGAGAAAGGATGG - Intronic
1166382832 19:42363672-42363694 AGAGAGAAAGAGAGAGAGGAGGG - Intronic
1166501009 19:43341283-43341305 AGAGAGAGACAGAGAGTGAAGGG - Intergenic
1166551060 19:43666528-43666550 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166859216 19:45800204-45800226 AAGGAGAATAAGAGAGTGGGAGG - Intronic
1166984241 19:46649896-46649918 AAAAAAAAAGAGAGAGTGGAGGG + Intronic
1167031169 19:46961963-46961985 AAAGAGAAAGAGAGAAAGGAAGG + Intronic
1167084597 19:47300660-47300682 ACAGAGAAAGAGAGAGAGGAGGG - Intronic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1167239640 19:48335918-48335940 AAAGAGAAGAGGAGAGGGGAAGG + Intronic
1167260496 19:48455254-48455276 AAAGAGATGCAGAGATAGGCAGG - Exonic
1167282259 19:48576340-48576362 AAAGAGAAGTAGAGGGTAAAGGG - Intronic
1167348953 19:48963227-48963249 AAAGAGACCCAGAGAGAGGGGGG - Intergenic
1167368475 19:49066677-49066699 ACAGAGACCCAGAGAGTGAAGGG - Intergenic
1167413914 19:49360761-49360783 ACAGAGACCCAGAGAGGGGATGG + Intronic
1167440691 19:49507049-49507071 GAAGAGAAGAGGAGAGGGGAAGG - Intronic
1167514096 19:49912946-49912968 AAAGTGAAGCCCAGAGTGGCTGG + Intronic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690240 19:50980594-50980616 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690281 19:50980762-50980784 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1167763658 19:51464470-51464492 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1167789699 19:51666613-51666635 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1167932539 19:52878218-52878240 AAAGTGATGCACAGAGTGGCAGG - Exonic
1168001431 19:53449430-53449452 AATGAGAAGAAGAGAGGTGAAGG - Intronic
1168049676 19:53819828-53819850 AAAGAGAAAAAGAGAGGAGAGGG + Intronic
1168090006 19:54076174-54076196 AAACAGAAGATGAGAATGGAAGG - Intronic
1168261863 19:55199814-55199836 AAAGAGAAAGAGAGAAAGGAAGG + Intronic
1168542768 19:57226726-57226748 AAAGGGAAGCATGGAGTGAAAGG - Intergenic
1168612170 19:57810118-57810140 AAAGAGAAGAGGAGAGGAGAGGG + Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925169485 2:1742434-1742456 AAAAAGGAGCTGAGAGTAGACGG - Intronic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925709285 2:6722454-6722476 ACAGAGAAGCTGAGAGTGTGGGG - Intergenic
925777286 2:7347725-7347747 AAGGAGGAGAAGAGAGTGAAAGG - Intergenic
926362929 2:12107069-12107091 AAAGACAAGCATAGCATGGAGGG - Intergenic
926398196 2:12467455-12467477 AAAGAAAAAAAGAGAGTAGAAGG - Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926728681 2:16018176-16018198 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
927119873 2:19948567-19948589 AAAGAGAAACAGACAGCAGAAGG + Intronic
927283524 2:21333147-21333169 AAAGAGAATTGGAGAGTGAAGGG - Intergenic
927506115 2:23615925-23615947 AAAGAGAAGCAGAGGGGGTCTGG - Intronic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
927808759 2:26170490-26170512 AAAGAAAAGAAGGGAATGGAAGG - Intergenic
928061413 2:28117037-28117059 GAAGAGGAGCAGTGAGTGCAAGG + Intronic
928218018 2:29378707-29378729 AAAGAGAGGGAGGGAGGGGAGGG - Intronic
928256750 2:29729340-29729362 AGAGAAAAGAAGAGAGAGGAAGG + Intronic
928746725 2:34424749-34424771 AAAGAGAAGGAGAGAAAGGAGGG + Intergenic
928982699 2:37153318-37153340 AAAGATTAGCAGAGACTGAAAGG - Intronic
929452010 2:42044195-42044217 AAAGAGACAGAGAGAGAGGAAGG + Intergenic
929461796 2:42107400-42107422 AAAGAGAAGCAAAGAGCTGAAGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929741859 2:44610985-44611007 AAAGAGAAGTAGATAGAGAAGGG + Intronic
929744527 2:44642275-44642297 AAAGATAAGCAAAGAATGGGTGG + Intronic
929825124 2:45303988-45304010 AAAGAAAAGGAGAGAGAGAAAGG - Intergenic
929863469 2:45698607-45698629 AAAGAGAGGAAGAGAGGGGGAGG + Intronic
930136260 2:47906175-47906197 AAAGAGAGGGAGAGAAGGGAGGG + Intergenic
930352682 2:50277525-50277547 AGAGAGAAGAAGAGAAAGGAAGG - Intronic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930884708 2:56312115-56312137 TAAGAGAAGCACTGAGTGAATGG + Intronic
931085850 2:58830278-58830300 AAAGAGAGAGAGAGAGTGGGGGG - Intergenic
931096247 2:58943844-58943866 AGAGAGAAGTAGAGAGGGAAGGG - Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931191389 2:60003647-60003669 AAAGAGTAGCCAAGTGTGGACGG - Intergenic
931307237 2:61041643-61041665 AAAGATTAGCAGTGAATGGAAGG + Intronic
931469538 2:62524587-62524609 AAACAGAAGCAGATACTTGAAGG + Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932022020 2:68097002-68097024 AAAGAGAGTGAGAGAGTGGGAGG - Intronic
932305798 2:70703227-70703249 AAAGAGAAAGAGAGAGAGAAAGG + Intronic
932628454 2:73317967-73317989 AAAGAGAGGAGGAGAGGGGAGGG - Intergenic
933048200 2:77565982-77566004 GAAGAGAAGGAGAGAGATGAGGG - Intronic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933664062 2:84950476-84950498 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934607385 2:95707094-95707116 AAAGGGAAGAAGACAGTGGCTGG - Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934731888 2:96664136-96664158 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934903554 2:98179938-98179960 AAAGAGAAAGAGAGAAAGGAGGG - Intronic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935448206 2:103179400-103179422 AAATACAATCAGAGAGGGGAGGG + Intergenic
935531796 2:104241711-104241733 AAAGAGAAACATAGACTGAAAGG + Intergenic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
935685180 2:105676748-105676770 AAAGAGAGGGAGAGAGAGGGAGG - Intergenic
935703394 2:105834522-105834544 AAAGACACACAGAGACTGGAAGG - Intronic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
935787974 2:106566425-106566447 AAGGTGAAGAAGAGAGGGGAAGG + Intergenic
936061524 2:109298198-109298220 AAATAGATGCAGAGAAGGGAAGG + Intronic
936475823 2:112838925-112838947 AAAGAGAAAGAGAGAGAGAAGGG - Intergenic
936502070 2:113074458-113074480 AAAGGGAAGAAGAGAAGGGAGGG - Intronic
936662944 2:114562201-114562223 AAAAGGTAGCATAGAGTGGAAGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
937209849 2:120261373-120261395 AAGGAGAAGAAGGGCGTGGAAGG + Intronic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
937617320 2:123941273-123941295 GAAGACAACCAGACAGTGGAAGG + Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
938266624 2:129932870-129932892 AAACAGCACCAGAGAGGGGAAGG + Intergenic
938397493 2:130962251-130962273 AAAAGGAAGCAGAGGCTGGAAGG + Intronic
938605221 2:132885281-132885303 AAGGATAAGCAGAGAGGGAAAGG + Intronic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939287153 2:140146726-140146748 AAAGAAAAGGAGAGTGTAGAAGG - Intergenic
939298220 2:140297538-140297560 AAAGAGGGGAAGAGAGAGGAAGG + Intronic
939637301 2:144597996-144598018 TAATAGAACCAGAGAATGGATGG + Intergenic
939659308 2:144868587-144868609 GAAGAGAGGGAGTGAGTGGAGGG - Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940124453 2:150309098-150309120 CAAGGGAAGCAGAGAGTGATTGG + Intergenic
940274564 2:151925680-151925702 AAAGAGGAGCAGGGAGGGGGTGG + Intronic
940312973 2:152297897-152297919 AAAATGAAGCAGAGAGAGGCTGG + Intergenic
941013713 2:160330978-160331000 AAACGGAGGCAGAGATTGGAGGG + Intronic
941060324 2:160840013-160840035 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
941086988 2:161129449-161129471 AAAGAGGAGAAGAGAATAGAGGG - Intergenic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941451547 2:165666253-165666275 AAAGAAAGACAGAGAGAGGAAGG + Intronic
941451582 2:165666515-165666537 AAAGAAAGACAGAGAGAGGAAGG + Intronic
941528827 2:166639034-166639056 AAAGATAAGAAGTGATTGGAAGG + Intergenic
941729217 2:168897297-168897319 AAAGAAGAGAAGAGAGTAGAGGG - Intronic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942309766 2:174645015-174645037 ATAGAGAAGCCTAGAGTAGAGGG + Intronic
942371319 2:175288707-175288729 GAAGGGAATCAGAGATTGGATGG - Intergenic
943581489 2:189688814-189688836 AAAGTGAAGCAGGGACTTGAAGG + Intronic
943781468 2:191828956-191828978 GAAGAGAAGCCCTGAGTGGAAGG - Intergenic
943819137 2:192297596-192297618 AAAGAGAAAAAGAGATTAGAAGG - Intergenic
943840352 2:192573116-192573138 AAAGAGATGGAGAGATTGAAAGG + Intergenic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
943994621 2:194745460-194745482 GAAGAAATGCAAAGAGTGGAAGG - Intergenic
944479378 2:200140030-200140052 AAAATACAGCAGAGAGTGGAAGG - Intergenic
944692471 2:202170321-202170343 AGTGAGAAACAGAGATTGGAAGG - Intronic
945216096 2:207435814-207435836 AAACATAAGCAGAGAATGGTAGG - Intergenic
945322305 2:208438795-208438817 CAAGAGAAGTAGTGAGTTGAAGG + Intronic
945458320 2:210074263-210074285 AAAGACAAGCAGAGTTTTGAAGG - Intronic
945863011 2:215145148-215145170 AAAGAGAAGAAGGAAATGGAAGG - Intergenic
946175714 2:217920994-217921016 AGAGGGAAGAGGAGAGTGGAGGG + Intronic
946431688 2:219629810-219629832 AAAGAGGAGCAGGGTGTGGGAGG + Intronic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
946589804 2:221232851-221232873 AGAGACAAGAAGAGAGGGGAGGG + Intergenic
946837182 2:223784068-223784090 AAAGCAAAGATGAGAGTGGATGG - Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947429389 2:230012378-230012400 AATGAGAAGCAGAGAGGGCTAGG - Exonic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947702134 2:232243334-232243356 AAAGAGAAGCCTGGAGTGGTAGG + Intronic
947865516 2:233395611-233395633 AGAGAGAAGCGGGGAGGGGAGGG - Intronic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948301357 2:236909570-236909592 AATCAGAAGCCGAGACTGGAGGG - Intergenic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
948382107 2:237557994-237558016 AGATGGAAGCAGAGACTGGAGGG - Intergenic
948434986 2:237946995-237947017 AGAGAGAGAGAGAGAGTGGAAGG - Intergenic
948516567 2:238507647-238507669 AAAGAGACACACAGAGTGGCCGG - Intergenic
948583943 2:239006812-239006834 ACAGTGGAGCAGAGAGTGGAAGG - Intergenic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1168919422 20:1518622-1518644 AAAGTGAATGAGAGAGAGGATGG + Intergenic
1169245049 20:4018512-4018534 AAAGAGAATGAGAGAATGAACGG + Intergenic
1169594542 20:7183070-7183092 AAAGAGGAACAGAGAGTAAATGG - Intergenic
1169804665 20:9547127-9547149 AAGGCAAAGCAGAGACTGGAGGG + Intronic
1169833762 20:9854707-9854729 TAAGAGAATCAGAGAGTTGATGG + Intergenic
1169884986 20:10389221-10389243 AAAGAGAGGAAGAGACTGGGTGG + Intergenic
1169941954 20:10946787-10946809 AAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170064376 20:12294577-12294599 GAGGAGAAGCAGAGAGTGTGGGG + Intergenic
1170092742 20:12609177-12609199 GACGTGAAGCAGAGAGGGGAAGG - Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170161130 20:13312605-13312627 GGAGAGCAGGAGAGAGTGGAAGG - Intergenic
1170378885 20:15734246-15734268 AGAGAGAAGAACAGGGTGGAAGG + Intronic
1170465714 20:16620757-16620779 AAAGAGAATAAGAGAAGGGATGG - Intergenic
1170541375 20:17391891-17391913 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1170709079 20:18774073-18774095 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1170790193 20:19502037-19502059 GAAAACAAGCAGAGACTGGAGGG + Intronic
1170858458 20:20079490-20079512 GAAGGGAAGCAGAGAGAGGGAGG + Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171112893 20:22500611-22500633 AGAGACAAGCAGAGTGTGGTGGG - Intergenic
1171147124 20:22794729-22794751 AAAGAGAAGCTGATTATGGAGGG + Intergenic
1171527038 20:25821876-25821898 AAAGAGAACCAAGGAGAGGATGG + Intronic
1171549789 20:26034008-26034030 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1171908118 20:30917979-30918001 ATTGAGAATCATAGAGTGGAAGG - Intergenic
1172072420 20:32268005-32268027 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1172171745 20:32939637-32939659 AAAGAGAGACAGAGAGAGAAAGG - Intronic
1172320621 20:33993317-33993339 GAAGAGAAGCTTAGAGTGGGAGG - Intergenic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1172781760 20:37440587-37440609 AAAGAGAACAAGAGAGTTAAAGG - Intergenic
1172809734 20:37638697-37638719 AAAGAGGCCCAGAGAGGGGAAGG - Intergenic
1172858748 20:38030258-38030280 GGAGGGAAGCAGGGAGTGGAGGG + Intronic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1173007998 20:39155914-39155936 GATGAGAAGAAGAGAGGGGAAGG + Intergenic
1173179079 20:40788509-40788531 AGAGGAAAGGAGAGAGTGGAAGG - Intergenic
1173240380 20:41290648-41290670 AAACAGATGCAGAGAGGTGAAGG + Intronic
1173333073 20:42091788-42091810 AAAGAGAGGGAGAGAGAGGGGGG + Intronic
1173582850 20:44159672-44159694 AAAGTGGAGCACAGTGTGGAGGG - Exonic
1173644255 20:44623706-44623728 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1173845976 20:46189067-46189089 AGAGAGAAACAGAGATAGGAAGG + Intronic
1174046708 20:47738994-47739016 AAAGGGAAGCAGAGACTGGAGGG + Intronic
1174080935 20:47970364-47970386 GATGAGAAGCGGAGTGTGGAAGG - Intergenic
1174664659 20:52246798-52246820 AAAGGGAAGCAGAGAGTCCTTGG + Intergenic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1175162078 20:57016044-57016066 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175339685 20:58220508-58220530 AGAGAGAGAGAGAGAGTGGAAGG + Intronic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175831464 20:61967251-61967273 GAAGAGCAGCACAGAGTGGAAGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175921348 20:62451857-62451879 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1175921383 20:62451972-62451994 AAAGAGAAAGAGGGAGAGGAGGG + Intergenic
1175986527 20:62766671-62766693 AGAGGGAAGCACGGAGTGGAAGG - Intergenic
1176017108 20:62939894-62939916 AAAGAGAAAGACAGAGTGGACGG + Intronic
1176290004 21:5038640-5038662 ACACAGAAGCACAGCGTGGAAGG + Intronic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177163795 21:17577822-17577844 TAGGAGAAGCAGAGAGTGCCAGG - Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177383177 21:20371936-20371958 AAAGAGAAGAAGAGATTTGAAGG + Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177657810 21:24041861-24041883 AAAGAGATCAAGAGAGAGGATGG - Intergenic
1177836382 21:26190095-26190117 AAAGAGAAGCAAGCAGAGGAGGG + Intergenic
1177922405 21:27169043-27169065 AAGGAGAAGTACAGAGTGAAGGG - Intergenic
1178642419 21:34355818-34355840 AAAGAAAAGCAGAGGCTGGAGGG + Intergenic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1178682415 21:34684009-34684031 GAAGAGAAACAGTGAGTTGAGGG - Intronic
1178742369 21:35213876-35213898 AAATAGGACCAGTGAGTGGAAGG + Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1179137212 21:38690125-38690147 AAAGAGAGACAGAGAGAGAAAGG - Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179867250 21:44224999-44225021 ACACAGAAGCACAGCGTGGAAGG - Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180151929 21:45952982-45953004 AAAGAAATGCAAAGATTGGAAGG - Intergenic
1180237878 21:46475755-46475777 AAATGGAATCAGAGAGTGAATGG - Intronic
1180638059 22:17276416-17276438 AAAGAGAAGAGGGGAGGGGAGGG + Intergenic
1180703105 22:17792437-17792459 CAAGGGACGCAGAGAGTGCAAGG - Intronic
1180892245 22:19297552-19297574 GAAGAGAAGAAGGGAATGGAAGG + Intergenic
1181286928 22:21759104-21759126 AAAGAGAAGCAGTGCAGGGATGG - Exonic
1181418550 22:22779674-22779696 AAAAAGAAGGAGAGAAGGGAAGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181535018 22:23537296-23537318 AAAGAGGAGCAGAGAGAAGGAGG + Intergenic
1181937753 22:26450755-26450777 AAAGAGAAGTGCAGAGTGAAAGG - Intronic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182650783 22:31849444-31849466 AAGGAGAAGTGCAGAGTGGAGGG + Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182909128 22:33965932-33965954 AAATAGTAGCAGAGACAGGAAGG - Intergenic
1183114846 22:35683576-35683598 AAAGAGAAGGAGAGAAGGAATGG + Intergenic
1183130435 22:35829560-35829582 AAAAAGAAACAGAGAGAGGGAGG + Intronic
1183238555 22:36638636-36638658 AAAGTGAAGTAAAGAGTGCAGGG - Intronic
1183273766 22:36878325-36878347 ACAGAGCAGCAGAGACAGGAAGG - Intergenic
1183352673 22:37342815-37342837 AAAGGGAAGCGGGGAGGGGAGGG + Intergenic
1183594629 22:38803196-38803218 AAAAAGAAAGAGAGAGAGGAAGG - Intergenic
1183751143 22:39721328-39721350 GAATAGAAGCAGACAGTGAAAGG - Intergenic
1183814776 22:40290581-40290603 GCAGAGAAGCAGAGAGCTGAAGG - Intronic
1183827171 22:40397658-40397680 AATGAGAAGGAAAGAGTGGGAGG - Intronic
1183861004 22:40669963-40669985 CAAGGGAAGCAGAGAGGGGTGGG - Intergenic
1183935232 22:41258112-41258134 AAGAGGAGGCAGAGAGTGGAGGG + Intronic
1184271368 22:43386190-43386212 AAAGAGAAAGAAAGACTGGATGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184426328 22:44411193-44411215 GGGGAGAAGCACAGAGTGGACGG - Intergenic
1184521052 22:44994376-44994398 AGACAGAGGCAGAGACTGGAGGG + Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1185012393 22:48321751-48321773 AAAGAAAAGAAGAGAGAGCATGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185160307 22:49222714-49222736 AAAGAGAAGAACAAAGTTGAAGG + Intergenic
1185414311 22:50701354-50701376 AAAGGGAAGGAGGGAGGGGAGGG - Intergenic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949346856 3:3084776-3084798 AAACAGATGCAGAGAGGTGAAGG - Intronic
949483984 3:4519892-4519914 AAGGAGAGGCAGAGAGTGTCTGG + Intronic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
949743044 3:7258434-7258456 CAAGAGAGGAAGAGAGTGGTAGG + Intronic
950128085 3:10523053-10523075 AAAGAGAGGCCAAGAGTGAAAGG + Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950601150 3:14036929-14036951 AGAGAGAAACAGAGAGTCAAAGG + Intronic
950644910 3:14371361-14371383 AAAGATGAGCCGATAGTGGAAGG - Intergenic
950694267 3:14685699-14685721 TCATAGAAGCAGAGAGTGAATGG - Intronic
950795946 3:15510801-15510823 AAAGAGACCAAGAGAGAGGAAGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951448351 3:22808204-22808226 AAGGACAAGAAGAGAGTGGCTGG + Intergenic
951742827 3:25943395-25943417 AAAGACAGGCAGTGAGTGGCAGG + Intergenic
951786628 3:26427362-26427384 AGAGAGAAACAGAGAGAGAAAGG + Intergenic
952227687 3:31395779-31395801 AAAGAGAAGCATTGTGTAGAGGG - Intergenic
952808965 3:37384678-37384700 AAAGACAAGCAAAGACTGCAGGG + Intergenic
953156199 3:40376978-40377000 AAAGAGAAGAAGAGAAAGGCAGG + Intergenic
953336426 3:42098163-42098185 GGAGAGAAGCAGAGAAAGGAGGG - Intronic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954405277 3:50341937-50341959 AGAGAGAAGTGGAGAGTGGCAGG + Intronic
954459110 3:50616576-50616598 AAAGGGAAGCAGCGAGTCAAGGG + Intronic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
954907672 3:54076708-54076730 AAAAAAAAACAGAGAGAGGAAGG - Intergenic
955011661 3:55022646-55022668 GAAGAAAAGGAGAGAGAGGAAGG - Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955445027 3:59000679-59000701 AAATGGAGGCAGAGAGTGGGTGG + Intronic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955748887 3:62167944-62167966 ACAGAGGACCAGAGAGGGGAGGG - Intronic
955932237 3:64068501-64068523 AAAGAGAAGCAAAGAGAGAGGGG + Intergenic
956191547 3:66612931-66612953 AAAGAGAAAGAGAGAAAGGAAGG - Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956465126 3:69512496-69512518 AAAGAGAAGCAGAGAATCTAGGG + Intronic
956547778 3:70424967-70424989 AAAAAGAAGGAGGGAGAGGAAGG + Intergenic
956732487 3:72209511-72209533 AGAGAGAATGAGAGAGGGGATGG + Intergenic
956824957 3:72989067-72989089 AAATAGAAACAGAGATTGGCCGG - Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956887591 3:73575956-73575978 AAAGAGAGACAGAGAGGGGCAGG + Intronic
957029976 3:75229086-75229108 AAAGAGAAGGAGAGAGTTAGAGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957188970 3:76981840-76981862 AGAGAGAGCGAGAGAGTGGATGG + Intronic
957379191 3:79403121-79403143 AAACAGAAACAGAGGGTGGGAGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957422002 3:79982447-79982469 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957711221 3:83861348-83861370 AAAGAGAAGCTGATAAGGGATGG - Intergenic
957875738 3:86144024-86144046 AGAGAGAGGCAGAGAAGGGATGG - Intergenic
957960399 3:87242872-87242894 AAAAAGAAGTACAAAGTGGAAGG - Intronic
958001745 3:87759453-87759475 AAAGAGAAGAACAAAGTGGGAGG + Intergenic
958090131 3:88866880-88866902 AATGAGAAACAGAGAGAGCATGG + Intergenic
958637003 3:96757709-96757731 TAATAGAAACAGAGAGTAGAAGG - Intergenic
958835650 3:99141528-99141550 AAAGAGGAGCAGAGAATGTAGGG - Intergenic
959309423 3:104714537-104714559 ACATAGAAACAGAGAGTCGAAGG + Intergenic
959315462 3:104800393-104800415 AAAGAGGAGAAGAGACTGGTTGG + Intergenic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
959598680 3:108154929-108154951 AAAAAGAAGAACAAAGTGGAGGG - Intergenic
959600078 3:108171892-108171914 AAAGAGAAACAGAGACTGTTAGG - Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
960347705 3:116555157-116555179 AAAGAGAGACAGAGAGGAGAGGG + Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960443829 3:117722783-117722805 AAAGTGAAGAAAAGAGTAGAAGG - Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960803719 3:121563150-121563172 AAAGAGATTTAGAGAGAGGAAGG + Intergenic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961004568 3:123396236-123396258 AAAGAGAAAAAGAGAGAGGGAGG + Intronic
961066362 3:123880585-123880607 GGAGAGGAGCAGAGGGTGGAAGG + Intronic
961438283 3:126934522-126934544 AAAAAAAAGCAGAGAGGGGAGGG - Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
962006377 3:131353945-131353967 AAAGAGAAGGAGAAAGTGTGGGG + Intergenic
962072143 3:132044561-132044583 AAAGAGAGGAAGGGAGGGGAAGG + Intronic
962174434 3:133138203-133138225 AAAGAGGAACAGAAAGTGGGAGG + Intronic
962389980 3:134963052-134963074 TAAGAGAAGTAGGGAGTGCATGG - Intronic
962436388 3:135370953-135370975 ATAGAGTGGCAGAGAGTGGAAGG - Intergenic
962587639 3:136858762-136858784 AAAGGAAAGCATAGACTGGAAGG - Intergenic
962609905 3:137066427-137066449 AGAGAGGATCTGAGAGTGGAGGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962794541 3:138838972-138838994 ACAGAGAAACATAGAGAGGAGGG + Intergenic
962952517 3:140232454-140232476 AAAGAAGAGCAGAGAGTCCAAGG - Intronic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963333044 3:143937793-143937815 AAAGAGAGGGAGAGAAAGGAAGG - Intergenic
964014640 3:151930006-151930028 AAACAGGAGCAGAGAGGTGAAGG - Intergenic
964062987 3:152547158-152547180 AGGGACAACCAGAGAGTGGAGGG - Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964217042 3:154297108-154297130 GAGGAAAAGCAGGGAGTGGAGGG + Intronic
964622316 3:158730411-158730433 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
964734086 3:159898566-159898588 AAAGAAAAGAAGAAAGTGGAAGG - Intergenic
965431969 3:168599962-168599984 AAAAAAAAGCAGACAGGGGATGG + Intergenic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
965683520 3:171276688-171276710 AAAAAGAAGTGGAGAGTGCAGGG + Intronic
965752816 3:171994298-171994320 AGAGAGAAGCAGAGAGAATAAGG + Intergenic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966442454 3:179960873-179960895 AGAGAGAAGCTGAGAATGCAGGG + Intronic
966491141 3:180529776-180529798 AAAGAGAAGGGAAGAGTGGGAGG + Intergenic
966616465 3:181918789-181918811 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
966675318 3:182579949-182579971 AAAGTGAAGAAGGGAGTGAAGGG - Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
966916581 3:184587607-184587629 AATGAGAAACAGAGAGGGGCAGG - Intronic
967200383 3:187067538-187067560 GAAGAGAAACAGAAAGTGGCTGG - Intronic
967205113 3:187112548-187112570 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
967328484 3:188266501-188266523 GAAGAGAAGAGGAGAGGGGAGGG + Intronic
967383586 3:188887312-188887334 AAAGAGAAAGAGAGAGAAGAAGG - Exonic
967476860 3:189931989-189932011 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
967823782 3:193862448-193862470 AAATAGAATTAGAGAGAGGAAGG - Intergenic
967996207 3:195168603-195168625 AAGGAGAACCAGAGACTGGGAGG + Intronic
968135618 3:196217608-196217630 AAAGAGAAAGAGAGAGCAGAAGG + Intronic
968135630 3:196217668-196217690 AAAGAGAAAGAGAGAGTGAAAGG + Intronic
968150276 3:196332402-196332424 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
968339334 3:197941514-197941536 AAAGAGAAAGAGAGAAAGGAAGG - Intronic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968508154 4:981809-981831 AAAGAAAAAAAAAGAGTGGACGG - Intronic
968678148 4:1896727-1896749 AAAGAGAAAGAGAGAAGGGAAGG - Intronic
968700400 4:2054340-2054362 GAAGAGAGACAGAGAGTGAAGGG + Intergenic
969051528 4:4376701-4376723 CAAGAGAGGCAGAGACTGGAGGG - Intronic
969227134 4:5806074-5806096 AAAAAAAAAAAGAGAGTGGAAGG - Intronic
969485002 4:7467291-7467313 GGACAGCAGCAGAGAGTGGAAGG + Intronic
969644892 4:8422133-8422155 AAAGAGAAACAGAGAGAGAAAGG + Intronic
969659875 4:8520302-8520324 AGAGAGAAGCAGACAGTGTGGGG + Intergenic
969691498 4:8706507-8706529 TGAGAGAGGCAGAGACTGGAGGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
969973239 4:11070124-11070146 ATAGTGAAGCAGACAGTGAATGG - Intergenic
970364963 4:15349277-15349299 AAAAAGATGAAGAGAGAGGAAGG - Intronic
970588757 4:17540374-17540396 GGAGACAAGCAGAGTGTGGAAGG + Intergenic
970646557 4:18128179-18128201 AAAAGGAAGAAGAGAATGGATGG - Intergenic
970901718 4:21166957-21166979 AAAAAAAAGAAGTGAGTGGATGG + Intronic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971380779 4:26095603-26095625 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971565280 4:28131475-28131497 AAAGAGAGGGAGAGAGAGAAGGG + Intergenic
971740905 4:30519719-30519741 AAGGAGAAGCAGTGAATGGTTGG - Intergenic
971939122 4:33191038-33191060 AAAGTGAAACAGAGAGAGAAAGG + Intergenic
972025892 4:34376939-34376961 AAGGAGAAGCAGAAAGTGTGAGG + Intergenic
972096353 4:35351457-35351479 AAAGAGAGAGAGAGAGAGGAGGG + Intergenic
972129296 4:35809976-35809998 AGAAAGAAACAGAGAGAGGAGGG - Intergenic
972578722 4:40375954-40375976 AAAGAAAACCAGAGAGAGGAAGG - Intergenic
972732222 4:41806175-41806197 AAAGAGACAGAGAGAGGGGAAGG + Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
973265746 4:48208535-48208557 AAAGAACAGCAGAGAGGGAAAGG - Intronic
973312150 4:48721261-48721283 TCAGAGAGGTAGAGAGTGGAGGG + Intronic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973571646 4:52246210-52246232 AAAGAAAAGCCGAGAAAGGATGG + Intergenic
973660796 4:53104872-53104894 AAAGAGAATTAGAGAGTGGCTGG + Intronic
973722719 4:53741612-53741634 AAAGAAAACGAGAGAGGGGAAGG + Intronic
973836785 4:54817953-54817975 TGAGAGAAGTAGAGAATGGAGGG - Intergenic
974074317 4:57154900-57154922 AAAGGGAAAGAGAGAGAGGAGGG - Intergenic
974108780 4:57501855-57501877 GCAGAGAAGCAGAGATTGTAGGG + Intergenic
974111307 4:57528803-57528825 TAATAGAAACAGAGAGTAGAAGG + Intergenic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
974412887 4:61564847-61564869 AAAGAGAGGAAGAGAGGAGATGG + Intronic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974740713 4:66003087-66003109 TAATGGAAGCAGAGAGTAGAAGG - Intergenic
974817766 4:67027659-67027681 AAAGAGAGGCAGAGAATGCATGG - Intergenic
974867503 4:67598189-67598211 CAAGAGAAAAAGAGAGTGCAAGG - Intronic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975339667 4:73225384-73225406 GAAGAGAAGGGGAGAGTGAAAGG - Intronic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975454142 4:74569721-74569743 TAATGGAAGCAGAGAGTAGAAGG + Intergenic
975468108 4:74732958-74732980 AGAGAGAAAGAGAGAGAGGATGG + Intergenic
975628523 4:76375049-76375071 AAAGATAAATAGAGAGTGAAAGG + Intronic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
975842463 4:78489475-78489497 GAAGAGAAGGAGGGAGAGGAGGG + Intronic
976489049 4:85645672-85645694 AAAAAGAAGCACATATTGGAAGG + Intronic
976520045 4:86016326-86016348 AAAGAGTAGGAGAGACTGGAGGG - Intronic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976677349 4:87718067-87718089 AAAGAAAAGCAAAGACTTGAAGG + Intergenic
976716648 4:88129987-88130009 AAAAAGAGGCAGAGAAGGGAGGG + Intronic
976785136 4:88811165-88811187 AAAGAAAAGCAGAGAGAAAATGG + Intronic
976788002 4:88844636-88844658 AAAGACAAGCATAGAGTTGGGGG + Intronic
977275076 4:94967462-94967484 AAAGAGAAGGAGAGAGGAGAGGG - Intronic
977401864 4:96542497-96542519 AAAGAGGATCAGAGAGAGGCAGG + Intergenic
977700376 4:100015304-100015326 AAAGAGAAGGATAGAGGAGATGG - Intergenic
977900236 4:102414092-102414114 AGAGAGACAGAGAGAGTGGAAGG - Intronic
977996151 4:103499166-103499188 AGAGAGAACTAGAGAGTGAATGG + Intergenic
978068061 4:104430896-104430918 AGAGAGAAAGAGAGAGAGGATGG - Intergenic
978193620 4:105945110-105945132 AAAGAAAAACACAAAGTGGAGGG - Intronic
978293331 4:107173091-107173113 AAAGAACATCAGAGAGGGGATGG - Intronic
978445502 4:108776433-108776455 AAAGTGAAGCAGAGATGGTAAGG + Intergenic
978469059 4:109041762-109041784 ATAGATAAGGAAAGAGTGGAGGG - Intronic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979361271 4:119767818-119767840 AAAAAGTAGATGAGAGTGGAAGG + Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979776961 4:124601832-124601854 AAAAAAAAGCAGAGATTTGAGGG - Intergenic
979972857 4:127159174-127159196 AAAGAAAAGCAGATACTAGAAGG + Intergenic
980568898 4:134584164-134584186 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
980871443 4:138615636-138615658 ACAGAGAAGCAGAGAATAGAAGG + Intergenic
981252170 4:142616374-142616396 AAAGAGGATCAGAGAGAGGGAGG + Intronic
981355827 4:143788022-143788044 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981367364 4:143918679-143918701 AAAGAGAAGAGAATAGTGGAAGG + Intergenic
981375988 4:144016434-144016456 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981377150 4:144028913-144028935 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981386514 4:144137793-144137815 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981467339 4:145088466-145088488 AGAAAGAAGGAGGGAGTGGAGGG - Intronic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
981619339 4:146676369-146676391 GAAGAGAAGAAGAAAGTAGAAGG - Intergenic
981906777 4:149930031-149930053 AAAGAGGACTAGAAAGTGGAAGG + Intergenic
982062727 4:151620943-151620965 AAACAAATGCAGAGAGTGGAGGG + Intronic
982754103 4:159198391-159198413 GAAGAGAGGAAGAGAGAGGAAGG - Intronic
983007627 4:162503990-162504012 AAAGAGAAGCAGAGACATGTAGG + Intergenic
983072972 4:163291776-163291798 AAAGAAAAGAAGAGAAGGGAAGG + Intergenic
983632509 4:169863613-169863635 AAGGACAAGCAGAGAGGGCAAGG - Intergenic
984014078 4:174405140-174405162 AAAGAGAAGAGGAGAAGGGAGGG - Intergenic
984185870 4:176543184-176543206 AAAGAGAAACAGAGATCTGAGGG + Intergenic
984404906 4:179315752-179315774 AAAGAGAAGAAAAAAGTTGAAGG - Intergenic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984622252 4:181967097-181967119 GTAGACAAGCAGGGAGTGGAAGG - Intergenic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
984859040 4:184220206-184220228 AAAGCGAAGAAGAGAAGGGAAGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985830488 5:2224425-2224447 AACGAGGAGCAGGGACTGGAAGG + Intergenic
985850860 5:2388254-2388276 AAAGAGAGGGAGAGACGGGAGGG - Intergenic
985898574 5:2766528-2766550 AAAGGGAAGAAGAGAGGGCAGGG - Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
986149298 5:5112237-5112259 AAATAGAAGCAGACAGTGAATGG + Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986662162 5:10068970-10068992 TCATAGAAGCTGAGAGTGGAAGG - Intergenic
986688640 5:10295814-10295836 AATGAGAAGCAGAGTGTTGTGGG - Intronic
987036417 5:14023484-14023506 AGAGAGAAGCAGAGATTAGGAGG - Intergenic
987041882 5:14070581-14070603 AAAGAAAAACAGAGAGTAAAAGG + Intergenic
987120139 5:14759773-14759795 AAAAAGAAGAGGAGAGGGGAGGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987174150 5:15289744-15289766 AAAGAGAAGGATTGTGTGGAAGG - Intergenic
987189829 5:15464938-15464960 AAAAAGAAGAACAGAGTAGAAGG - Intergenic
987339051 5:16923050-16923072 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
987532433 5:19139856-19139878 AGATAAAAGCAGAGAGTGGTAGG + Intergenic
987713518 5:21535042-21535064 AAAAAGAAGGAGAGAATAGATGG + Intergenic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
987820398 5:22958685-22958707 GAAGATAAGTTGAGAGTGGAAGG - Intergenic
988216287 5:28277770-28277792 GAAGAGAAAGAGAGAGAGGAAGG - Intergenic
988404613 5:30808168-30808190 AAACAGAAGAAAAGAATGGAGGG + Intergenic
988801191 5:34698136-34698158 GAAGGGAGGCAGAGAGGGGAGGG - Intronic
989007045 5:36826765-36826787 AAAGAAAGGGAGAGAGAGGAAGG + Intergenic
989254607 5:39352633-39352655 AAAGAGATGAAGAGAATGGATGG - Intronic
989632618 5:43501552-43501574 AAAAATAAACAGGGAGTGGAGGG + Intronic
989755445 5:44947619-44947641 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
989814281 5:45717622-45717644 AAAGAGAAACAAAGGGTAGAAGG - Intergenic
990011313 5:51002462-51002484 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
990288283 5:54322736-54322758 AAAGGGCAGCAGAGAGATGATGG + Intergenic
990584754 5:57200165-57200187 AAAGAAAAGGAAAGAGAGGAAGG - Intronic
990794387 5:59523876-59523898 AGAGAGAAGTGCAGAGTGGAGGG - Intronic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
990907380 5:60819008-60819030 GAAGAGAAGAGGAGAGGGGAGGG + Intronic
991348269 5:65693231-65693253 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
991398619 5:66230640-66230662 AAAGATCAGCAAAGATTGGAGGG - Intergenic
991548615 5:67811838-67811860 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
991995957 5:72386876-72386898 AAAGAGAAGAATTGAGTGAAAGG - Intergenic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992252370 5:74888036-74888058 AGAGAGATGCATAGATTGGATGG - Intergenic
992335016 5:75758144-75758166 AAAGAAATGCACAGAATGGACGG + Intergenic
992358777 5:76014111-76014133 AAAGAGAAAGAGAGAGAGAAAGG + Intergenic
992850154 5:80798804-80798826 AGAGATAAGAAGAGAGGGGAGGG - Intronic
992915612 5:81450017-81450039 AATGAGAAGCGGAGGATGGATGG - Intronic
992929911 5:81632705-81632727 TAAGAGAAGGAGACAGTAGAGGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993129479 5:83877064-83877086 AAAGAGAAGCAGGGACAGGTAGG + Intergenic
993248003 5:85476756-85476778 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
993339098 5:86700452-86700474 AAAGAGAATCAAAGAATGCATGG - Intergenic
993359879 5:86961246-86961268 AAACTGAAGCAGAGAGTCAAAGG + Intergenic
993602603 5:89947107-89947129 AAGGGGAAGCAGAGAGTTGGGGG - Intergenic
993895561 5:93529517-93529539 AAAGAGATGAAGAGAGTTGCAGG - Intergenic
994248622 5:97510606-97510628 AATGAAAAGCAGAGAGTTGTAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994829245 5:104757045-104757067 AGAGAGAGGAAGAGAATGGAGGG + Intergenic
994853876 5:105091392-105091414 AAAGAGGAGGAAAGAGTGAAAGG + Intergenic
994857394 5:105141387-105141409 AAAGAGAAAGAGAAAGTGGGTGG + Intergenic
994864862 5:105255009-105255031 AGAGAGAAACAGAGGATGGAAGG + Intergenic
995101439 5:108311835-108311857 AAAGAGAAGAAGAGAGATAATGG + Intronic
995492788 5:112709959-112709981 AAAGAGAAAGAGAGAGAGAAAGG - Intronic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996501501 5:124222167-124222189 AAAGAGAAGAATAGAGGGGGAGG - Intergenic
996549050 5:124711439-124711461 AAAGTAAAGCAGAGAGGAGAGGG + Intronic
996633830 5:125666976-125666998 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
996981944 5:129507769-129507791 AAAGAAAGGGAGAGAGAGGAGGG + Intronic
997145576 5:131429432-131429454 AAATAGAACGAGAGAGTTGAAGG + Intronic
997318539 5:132958498-132958520 AAAGTGATGCAGAGATTGAAAGG + Intronic
997629091 5:135353156-135353178 AAAGGGAAGCAGGGAGTTGCTGG + Intronic
997641775 5:135453325-135453347 AAAGAGAAGAACAGAATTGAAGG - Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997904551 5:137803208-137803230 AAAGAGAGGAAGAGAGTAAATGG + Intergenic
998099917 5:139424208-139424230 AAACAGAGGCAAAGAGTGGCAGG + Intronic
998205296 5:140153280-140153302 GCAGAGAAGCAGTGAGAGGAAGG + Intergenic
998364525 5:141620357-141620379 AGACAGAATCAGAGAATGGAGGG + Intergenic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998454248 5:142258691-142258713 AGAAAGAGGCAGAGATTGGAGGG + Intergenic
998745734 5:145258003-145258025 AAAGAGAAAGAGAGAGTGAAGGG - Intergenic
998750768 5:145319040-145319062 ACAGAGAAGCAGAGAAGAGAAGG - Intergenic
998876101 5:146600985-146601007 AATGAGAATCAGAAAGTAGATGG - Intronic
999184770 5:149698869-149698891 AGAGGGAAGGAGAGAGCGGAAGG + Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999308760 5:150538000-150538022 AAAGTTAAGCAGGGAATGGAAGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999683980 5:154085991-154086013 AAAGAGATACAGAGAGAGAAAGG - Intronic
999703430 5:154249495-154249517 AAAGAGTAGGAGAGAATGGAAGG - Intronic
999745482 5:154588634-154588656 GAAGAGAAGCAGAGTCTGTATGG - Intergenic
999804195 5:155066829-155066851 AAAAGGAAGCAGAGAGGTGAAGG - Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1000649899 5:163804396-163804418 AGAGAGAAACAGAGAGAGAATGG - Intergenic
1000828455 5:166074824-166074846 GAAGAGAAGAGGAGAGGGGAGGG - Intergenic
1000839637 5:166201851-166201873 AAAATGAAGCAGAGAGAGCAGGG - Intergenic
1000877133 5:166654795-166654817 AAAGAGAAAGAGAGAATGAAAGG + Intergenic
1000957694 5:167562024-167562046 AAAGAGATGGTGAGCGTGGAGGG + Intronic
1000990682 5:167908469-167908491 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1000990699 5:167908516-167908538 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001307700 5:170587643-170587665 TGACAGAAGCAGAGATTGGAGGG - Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001646099 5:173283443-173283465 TAAGAGAGGGAGAGAGGGGAAGG + Intergenic
1001741565 5:174057181-174057203 GAAGAAAAGTAGAGAGGGGAGGG - Intronic
1001799856 5:174533651-174533673 AAAGAGCAGCAAGGAGTAGATGG + Intergenic
1001867014 5:175114537-175114559 ATAGAGATGCAGAGTGTGAATGG - Intergenic
1002103869 5:176870340-176870362 AGAGACAAGCAGAGAGGAGACGG - Intronic
1002519816 5:179786086-179786108 AAAAATTAGCAGAGAGTGGTGGG + Intronic
1002606237 5:180384692-180384714 AAAGAAAAGAAAAGAGTGGAGGG + Intergenic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003340864 6:5219444-5219466 AAAGAGCAGGAAAGAGAGGAGGG - Intronic
1003515103 6:6811328-6811350 AAAGAAAAGTAGAGAGTATAAGG + Intergenic
1003604820 6:7549748-7549770 AAAGAAGAGGAGAGAGAGGAAGG + Intronic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003926888 6:10884529-10884551 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1004012446 6:11702654-11702676 CAAACGACGCAGAGAGTGGAGGG + Intergenic
1004154965 6:13159268-13159290 TAAGAGAAGAAGGCAGTGGAGGG + Intronic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004290074 6:14358745-14358767 AAACAGAAACAGAGAAAGGAAGG - Intergenic
1004506064 6:16247731-16247753 AAACTGAGGCAGAGAGGGGAGGG + Intronic
1004542361 6:16563104-16563126 AAAGGGAAAAAGAGAGTAGAAGG + Intronic
1004618812 6:17315438-17315460 TAAGGGAAGCAGGGGGTGGAAGG + Intergenic
1004627792 6:17393490-17393512 AAAGGGGAGCAGAGAGGAGAAGG - Exonic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005260112 6:24050005-24050027 AAAAAGGAGGAGAGAGTTGATGG + Intergenic
1005285842 6:24326130-24326152 AAAAAGAAGGAAAGAGAGGAAGG + Intronic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005835573 6:29706216-29706238 AAAGAGAAACAGAGACGGGCAGG - Intergenic
1005986938 6:30881502-30881524 GGAGTGAAACAGAGAGTGGAGGG - Intronic
1006104988 6:31711061-31711083 AAATAGAAGCACAAAGTGGGAGG + Intronic
1006290827 6:33135235-33135257 AAAGAGAGAGAGAGAGTGGAAGG - Intergenic
1006388860 6:33747053-33747075 AAAGAGGAGGAGAGAGAAGAGGG + Intergenic
1006521440 6:34573466-34573488 AAAAAAAAGAAGAGAGAGGAAGG + Intergenic
1006572474 6:35017308-35017330 GGAGAGAAGAAGAGAGAGGAAGG - Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007107619 6:39294562-39294584 AGAGAAAGTCAGAGAGTGGATGG + Intergenic
1007415245 6:41687820-41687842 AAAGAGAAGGAGAGAGGAGCTGG + Intronic
1007479790 6:42142419-42142441 AAAAAGAAGCAGACGGTGCAGGG - Exonic
1007630276 6:43269617-43269639 AAAGAGACCAAGAAAGTGGAGGG - Intronic
1007744948 6:44038097-44038119 AAAGAGGAGCACAGACAGGATGG + Intergenic
1008016296 6:46524050-46524072 AAAAAGAGGCTGAGATTGGATGG - Intergenic
1008491002 6:52087278-52087300 AAGGAGAAGCTGAGAGGGAAGGG - Intronic
1008803686 6:55401953-55401975 AAAAAGAAACAGAGAGGGGAGGG - Exonic
1009003200 6:57746855-57746877 AAAAAGAAGGAGAGAATAGATGG - Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009243104 6:61203250-61203272 AAAGAGAAAGAGAGAAAGGAGGG + Intergenic
1009390777 6:63140633-63140655 AAAGAGAAGGGAAGAGGGGAAGG + Intergenic
1009455091 6:63847394-63847416 AAAGAGAAAAAGGGAGAGGAAGG - Intronic
1009704031 6:67221447-67221469 AAAGAGAGGCAGATAGAGTAAGG + Intergenic
1010138230 6:72581169-72581191 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1010335256 6:74674039-74674061 AGAGAGGAGAAGAGAGAGGAAGG - Intergenic
1010772330 6:79845892-79845914 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1010935884 6:81860997-81861019 AAAGAGAAGGAAAGAAGGGAGGG - Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011158412 6:84359757-84359779 AAAGACAAGAAGAGAGAGAAAGG - Intergenic
1011398275 6:86933500-86933522 AAAGAGAAGCATGCACTGGAGGG + Intergenic
1011548324 6:88504594-88504616 AAAGAGAAGCTGACAGAGCAGGG - Intergenic
1011633128 6:89346495-89346517 ATAGAAAGGCTGAGAGTGGAGGG - Intronic
1012011029 6:93785707-93785729 AAAGGGAAGGAGAGAGGGGATGG - Intergenic
1012085597 6:94822356-94822378 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012085605 6:94822422-94822444 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012819008 6:104061363-104061385 AAAGAGAATTAGAGAGAGAAGGG + Intergenic
1013141605 6:107341543-107341565 AAAGAAAAGAAGAGAAGGGAAGG + Intronic
1013395374 6:109732013-109732035 AAAGAGATGCATGGACTGGAAGG + Intronic
1013443582 6:110197623-110197645 TCATAGAAGCAGAGAGTGAATGG - Intronic
1013445904 6:110226564-110226586 AAAGAAAAGAAAAGAGGGGAGGG - Intronic
1013716087 6:112963650-112963672 AGAGAGAAGGAGAGAGGGAAAGG + Intergenic
1013999889 6:116352919-116352941 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014428873 6:121342248-121342270 AAAAACAGGCAGAGAGTGGGGGG + Intergenic
1014615478 6:123592842-123592864 AGATAGAAGCAGACAGTGAATGG - Intronic
1015020049 6:128462506-128462528 AAATAGATCTAGAGAGTGGAGGG + Intronic
1015146127 6:129989739-129989761 AGAGAGAGGAAGAGAATGGATGG + Intergenic
1015511508 6:134042505-134042527 AAAGAGAAAGAGAGAATGAAAGG + Intronic
1015848357 6:137546049-137546071 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1015861917 6:137690325-137690347 AAAGAGCAGAAGGGAGTGGGAGG + Intergenic
1015911740 6:138175360-138175382 AAAGAGAAGCAAAGATAGCAAGG - Intronic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1017081482 6:150673595-150673617 AAAGACAGGAAGAGAGAGGAAGG - Intronic
1017138835 6:151171968-151171990 AGAGAGAAAAAGAGAGAGGAAGG - Intergenic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017408405 6:154143933-154143955 AAAGAGAAAGAGAGAGAGAAAGG + Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017683059 6:156883477-156883499 AAAGAAAAGCAAGGAGAGGAAGG - Intronic
1018281732 6:162193490-162193512 TAAGAGAAGAAGAGGATGGAGGG - Intronic
1018318813 6:162584890-162584912 AAAGAGAAGAGGAGAGGGGAGGG - Intronic
1018368197 6:163143820-163143842 AAAGAGATCCTGAGAGGGGACGG + Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1018625667 6:165776655-165776677 GAAGAGAAGGAGAGAGGAGAGGG - Intronic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019092268 6:169548603-169548625 AAAGAGAAGAACAAAGTTGAAGG + Intronic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019226356 6:170513322-170513344 AAAGCTAGGGAGAGAGTGGAAGG + Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019516778 7:1443663-1443685 AAACGGAGGCAGAGACTGGAGGG + Intronic
1019803518 7:3105704-3105726 AAAGAGAAACAAAAAGTGGCTGG - Intergenic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1019821000 7:3242661-3242683 AGAGAGAGACAGAGAGAGGAGGG - Intergenic
1019875236 7:3804505-3804527 AAAAAGAAGCAAAAAGTGGGAGG - Intronic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020593560 7:10174082-10174104 AAAAAGAAGAAGAAAGTTGAAGG - Intergenic
1020712277 7:11622945-11622967 AAATAAAGGCAGAGAGTTGAAGG + Intronic
1020991002 7:15196006-15196028 AAAGAAAAGAAAAGAGAGGAGGG - Intergenic
1021211022 7:17852385-17852407 AAAGAAAAAAAGAGAGGGGAGGG + Intronic
1021373285 7:19877206-19877228 AAAAATAAGAAGAGAGGGGAGGG - Intergenic
1021604622 7:22397503-22397525 AAATAGAAGCACAGAGTGTGAGG - Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021754507 7:23838422-23838444 AAAGAGACACAGAGACTGAAGGG + Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1021981012 7:26055644-26055666 AGAGAGAAGCTGAAAGTGAATGG + Intergenic
1022012791 7:26323519-26323541 GAGGAGAGGAAGAGAGTGGAAGG + Intronic
1022028488 7:26469991-26470013 AAAGAGAAGGAAAGAAAGGAAGG + Intergenic
1022041715 7:26587922-26587944 AAAGAGAAGCAAATAGGGGGAGG + Intergenic
1022661449 7:32371107-32371129 AAAAAGAACCAGAGACTGGAAGG - Intergenic
1022662516 7:32380213-32380235 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1022926440 7:35059643-35059665 GAATTGAAGCAGAGAATGGATGG - Intergenic
1023197150 7:37653487-37653509 AAATAGAAGCAGAGTATAGAGGG - Intergenic
1023747572 7:43335852-43335874 AAAGAGAAAGAGAGAGATGAAGG - Intronic
1023784319 7:43691326-43691348 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1023803258 7:43853007-43853029 AGAGAGAGGGAGAGAATGGATGG - Intergenic
1023842249 7:44104251-44104273 AAGGAGGAGCCGAGAGTGGACGG - Intergenic
1023999171 7:45179706-45179728 AAAGAGAACAGGAGAATGGAAGG + Intronic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024099246 7:46012538-46012560 AAAAAGAAAAAGAGAATGGATGG + Intergenic
1024199916 7:47096212-47096234 AAAGAAAAGCAGATGCTGGAGGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024919899 7:54545381-54545403 AAAGAGACGGAGAGAGGGAAGGG + Intronic
1024919917 7:54545455-54545477 GAAGAGAAGGAGAGAGGGAAGGG + Intronic
1024920009 7:54545774-54545796 GAAGAGAAGGAGAGAGGGTAGGG + Intronic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1026078926 7:67199919-67199941 AAAGAGAAGAAGAGAAGAGAGGG + Intronic
1026300156 7:69090767-69090789 AAAGAAAAGAAAAGAGAGGAGGG + Intergenic
1026311687 7:69191321-69191343 GAAGAGAGACAGAGAATGGAAGG - Intergenic
1026453643 7:70552048-70552070 GAAGAGGAGAAGAGAGGGGAGGG + Intronic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026497319 7:70914296-70914318 AAAGAAAAGAAAAGAGGGGAGGG - Intergenic
1026529563 7:71185176-71185198 AGAGAGAGACAGAGAGAGGAAGG - Intronic
1026697894 7:72612020-72612042 AAAGAGAAGAAGAGAAGAGAGGG - Intronic
1026834844 7:73631796-73631818 AGAGAGGAGAAGGGAGTGGAGGG - Intergenic
1027187825 7:75982312-75982334 AACCAGAAGCCGTGAGTGGAGGG + Exonic
1027290700 7:76707343-76707365 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027769881 7:82393016-82393038 AAAGAGACAGAGAGAGAGGAAGG + Intronic
1027969313 7:85058028-85058050 AAAGCAAAGAAGAGATTGGATGG - Intronic
1028311182 7:89338522-89338544 AAAGAGAAAGAAAGGGTGGAGGG + Intergenic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1028920639 7:96306711-96306733 AAAGAGAAGATGGAAGTGGATGG - Intronic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029152429 7:98490500-98490522 GAAGACAGGCAGAGATTGGAAGG + Intergenic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029449412 7:100632528-100632550 AGAGAGAAACAGAGAAGGGAGGG - Intronic
1029522473 7:101072206-101072228 AAAGAAAAGAAGAGAGGGGAAGG + Intergenic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029720660 7:102362311-102362333 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1030329603 7:108257110-108257132 AAAGAAAAGAAGAGAAAGGAAGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030899968 7:115111110-115111132 AGAGAAAAGAAGAGGGTGGAAGG - Intergenic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1030962287 7:115940678-115940700 AAAGAGGAACAAAGATTGGATGG - Exonic
1031050223 7:116937445-116937467 AAAGAGAAGCATAAAGTAAAAGG - Intergenic
1031051571 7:116950660-116950682 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031574849 7:123402952-123402974 AAAGAAAATCAGTGAGAGGAAGG + Intergenic
1031614471 7:123864729-123864751 CAAGAGAAACAGAGATTGCATGG + Intronic
1031744655 7:125478765-125478787 AAAGAGAAGAAGAGAGATTAAGG + Intergenic
1031895103 7:127339352-127339374 AAAGCGAGACTGAGAGTGGATGG - Intergenic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032045128 7:128600059-128600081 AAAGAGAGTGAGAGAGTGAAGGG + Intergenic
1032122084 7:129163946-129163968 AAAGAGAAAGGGAGAGGGGAGGG + Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032509505 7:132460784-132460806 AAACAAAAGCAGAGGGGGGATGG + Intronic
1032618384 7:133499720-133499742 CAAGAGCAGCACAGAGGGGATGG - Intronic
1032632299 7:133666989-133667011 AAAGAGAAACAGGGAAAGGAGGG - Intronic
1032832305 7:135640569-135640591 AAACAGAAGCAGACACTGGTAGG - Intronic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033464077 7:141575211-141575233 GAAGAGAAGCAGAGTATTGAGGG + Intronic
1033528951 7:142244232-142244254 AGAGAGAAACAGAGAGAAGAGGG - Intergenic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033753581 7:144379134-144379156 AGACAGAGGCAGAGATTGGAGGG - Intronic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034002528 7:147431489-147431511 AAAGAGAAGCAGAGGTTGTAGGG - Intronic
1034372660 7:150613626-150613648 AAAGACAAGCAGAGATTTGCAGG - Intergenic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034996439 7:155580203-155580225 ACAGAGAGGAAGAGACTGGAAGG + Intergenic
1035029759 7:155849464-155849486 AAAGACAAGCAGGGAGGAGATGG + Intergenic
1035092390 7:156324724-156324746 AAGGAGAGGGAGAGAGTGGGAGG + Intergenic
1035305573 7:157929272-157929294 TCAGAGGAGCAGAGAGCGGATGG - Intronic
1035309450 7:157955926-157955948 AAAGAGAGTCAGAGGTTGGAAGG + Intronic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035920066 8:3667304-3667326 AAAGATAAAAAGAGAGTGAAGGG + Intronic
1035971883 8:4258325-4258347 AAAGAGAGGGAGGGAGGGGAGGG + Intronic
1036005509 8:4657411-4657433 AAAGAGAGACAGAGAGGGAAGGG - Intronic
1036088671 8:5640687-5640709 AAAGAGAAAGAGAGAGAGAAAGG - Intergenic
1036189800 8:6660071-6660093 AAAGAGAAGCAAAGAAGGGGAGG - Intergenic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036411501 8:8506173-8506195 ACAGAGCAGCAGAGAGCGGTGGG + Intergenic
1036482072 8:9148852-9148874 AGAGAGAATAAGAGAATGGAGGG - Intronic
1037003641 8:13750193-13750215 ATAGAGAAGTACAGAGTGAAGGG - Intergenic
1037061928 8:14523779-14523801 AAAGGAAAGAAGAAAGTGGATGG - Intronic
1037204781 8:16303506-16303528 AAAGGAAAGCAGAGAGGGGAAGG - Intronic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1037640301 8:20736187-20736209 AAATAGAAGTGGAGAGGGGAGGG + Intergenic
1037656179 8:20886096-20886118 AAAGAGAAGAAAAGGATGGATGG + Intergenic
1037691739 8:21186529-21186551 AAAGAGAAGAGGAGCATGGAGGG - Intergenic
1037711037 8:21355595-21355617 AAACAGACCCAGAGAGGGGAGGG + Intergenic
1037747116 8:21654565-21654587 AAGGAGAAACAGAGACTGGCTGG - Intergenic
1037893145 8:22634715-22634737 ACAGCCAAGCAAAGAGTGGATGG + Intronic
1037957303 8:23069524-23069546 AAAGAGAAAGAGAGAAAGGAAGG - Intergenic
1038044094 8:23751446-23751468 AAAAAGAAGCAGAGAATGTAAGG + Intergenic
1038060742 8:23908951-23908973 AAAGTTAAGCAGAGAGTGAGGGG + Intergenic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1038365567 8:26929420-26929442 AAAGAGGAACAAAGAGTAGATGG + Intergenic
1038459073 8:27701562-27701584 AAAGAGAAAGAAAGAGAGGAAGG - Intergenic
1038571480 8:28666557-28666579 AAAGAAAAGAAAAGAGTGGCTGG - Intronic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1039129176 8:34242208-34242230 AGAGAGAAGGAGAGATGGGAAGG + Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039351256 8:36766383-36766405 AATGAGAAGAAGAGATTGGTGGG - Intergenic
1039560390 8:38507939-38507961 AGAGAGGAGAAGAGAGGGGAAGG - Intergenic
1039950183 8:42164929-42164951 AAAGAAAGGGAGAGAGAGGAAGG + Intronic
1040314734 8:46254949-46254971 AGAGACAAGCAGAGAGTAGAAGG + Intergenic
1040472360 8:47744886-47744908 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1040499600 8:47995246-47995268 AAAAAAAAGGAGAGAGTGAAAGG + Intergenic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1040741035 8:50576056-50576078 GAAGAAAAGCAGAGAGAGAATGG - Intronic
1040751058 8:50708700-50708722 AAACAGAAGCTGAGAGTGTTGGG - Intronic
1041118452 8:54563340-54563362 AAAGACTGGCAGTGAGTGGAGGG + Intergenic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041500512 8:58534239-58534261 AAAGGGAAGGAGACAGTGAAGGG - Intergenic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1042014466 8:64292749-64292771 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1042553689 8:70016279-70016301 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1042633141 8:70843607-70843629 AAAGCAAAGCAAAGATTGGATGG + Intergenic
1042836454 8:73083269-73083291 AAAGAGAATCAGAAAGTTGTAGG + Intronic
1042900916 8:73726561-73726583 AAAATGAAGCACAGGGTGGAAGG - Intronic
1042931852 8:74022080-74022102 AAAGAAAAGAAAAGAATGGAAGG + Intronic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1043097225 8:75990450-75990472 AAAAAGAAAGAGAGAGAGGAAGG + Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1044102903 8:88162764-88162786 ACAGAGAGACAGAGAGTGAAGGG - Intronic
1044387594 8:91607848-91607870 AAAGAGAGACAGAGAGCAGAAGG - Intergenic
1044542406 8:93422519-93422541 AATGAGAATCAGAGAGGAGAGGG - Intergenic
1044585966 8:93869511-93869533 AAAGAGAAGTAGGGGGTGGGGGG - Intronic
1045026038 8:98087617-98087639 AAAGAAAGGCAGGGAGGGGAGGG - Intronic
1045048254 8:98299765-98299787 AAAGAAAAAGAGAGAGAGGAAGG + Intergenic
1045233098 8:100324853-100324875 AAAGAGAAAGAGAGAAAGGAAGG - Intronic
1045555793 8:103213452-103213474 AAAGAGAAGACCAGAGTGGTTGG + Intronic
1045613661 8:103879140-103879162 AAAGATCAGTAGAGAGTGAAGGG + Intronic
1045931014 8:107626584-107626606 AAAGAGAAAAAGAGAGAGCAAGG - Intergenic
1046042486 8:108922933-108922955 AAAGAGAAGCACATATAGGATGG + Intergenic
1046048300 8:108988772-108988794 AAAGAGAAAGAGAGAGAGGCAGG + Intergenic
1046089790 8:109487875-109487897 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046495507 8:115009393-115009415 CAAGAGAAAGAGAGAGTGAAAGG + Intergenic
1046577333 8:116047261-116047283 TAAGAGGACCAGAGAGTAGAGGG + Intergenic
1047072013 8:121355736-121355758 TCATAGAAGTAGAGAGTGGATGG - Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047414678 8:124654374-124654396 ACAGAGGTGGAGAGAGTGGATGG - Intronic
1047509118 8:125502885-125502907 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1047717760 8:127611300-127611322 ACACAGAGGCAGAGACTGGAGGG + Intergenic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1047983814 8:130212113-130212135 AAAGGGAAGCAGAAAGTTGCTGG + Intronic
1047990170 8:130277891-130277913 ACAGAGATGTAGAGAGTGGCAGG + Intronic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048186298 8:132244365-132244387 AAAGAGAGACAGAGAGAGAAAGG + Intronic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048714022 8:137246839-137246861 AAAGAGAAGCAGTGAGTTAGAGG + Intergenic
1049108757 8:140629845-140629867 AAAGAAAAGAGGAGAGGGGAGGG + Intronic
1049270677 8:141694058-141694080 TAATAGAAGCAGAGGTTGGAGGG + Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049534783 8:143173877-143173899 AAAGAGAGACAGAGAGAGGGGGG + Intergenic
1049633473 8:143672564-143672586 AGAGAGAAAGAGAGAGGGGAGGG - Intergenic
1049729742 8:144170165-144170187 AATGAGGAGGAGAGAGAGGAGGG + Intronic
1049953971 9:674271-674293 AAGGATCAGCAGGGAGTGGATGG + Intronic
1049986221 9:954292-954314 AAAGTGAAGCAGAGAGAGAAGGG + Intronic
1050022205 9:1295933-1295955 AAAGGGAAGCAGAGAAATGAGGG - Intergenic
1050307020 9:4315046-4315068 GAAGAGCAGGAGAGAGTGGAAGG - Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051783380 9:20714695-20714717 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
1051868832 9:21713748-21713770 TAAGAGAAGCAAAGGGGGGAGGG + Intergenic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1052492252 9:29184732-29184754 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1052535780 9:29745214-29745236 AGAGAGAGGCACTGAGTGGAAGG - Intergenic
1052666114 9:31497166-31497188 AAAGGGAAGCAGAGAATGTCTGG - Intergenic
1052678049 9:31651877-31651899 AAAGAGAAGGAGAGACGGAAGGG + Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053060863 9:35030335-35030357 AAAGAAAAAAAGAGAGAGGAAGG - Intergenic
1053111013 9:35460377-35460399 AAAGAGAGGCAGAGAGAGAGGGG - Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053295255 9:36908254-36908276 AAAGAGAAGCCAAGAGTGGATGG + Intronic
1053308410 9:37000145-37000167 AGAGAGATACAGAGAGAGGATGG + Intronic
1053794970 9:41717965-41717987 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1054150204 9:61596859-61596881 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054183378 9:61930028-61930050 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1054469974 9:65527963-65527985 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054655128 9:67658446-67658468 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1055066605 9:72125343-72125365 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1055087433 9:72328347-72328369 AAATGGAGGCAGAGATTGGAGGG + Intergenic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055510086 9:76987516-76987538 AGAGAGAAAGAGAGAGTTGAGGG + Intergenic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1055664772 9:78542386-78542408 AAAAAGAGGAAGAGAGTGGATGG + Intergenic
1055716394 9:79122626-79122648 AAAGAGAAAGAAAGAGAGGAAGG + Intergenic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056098129 9:83274846-83274868 AAAGAGAAGAAGAGATAGCAGGG + Intronic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056177473 9:84049367-84049389 GAAGAGATGCAGAGAAAGGAAGG - Intergenic
1056285207 9:85080521-85080543 AAAGATGTTCAGAGAGTGGATGG + Intergenic
1056468743 9:86884745-86884767 AAAGAAAGGAAGAGAGAGGAAGG - Intergenic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056615284 9:88160245-88160267 AAAGAGGAGCAGGGGCTGGAGGG - Intergenic
1056835642 9:89953146-89953168 CAAGAGAAAAAGAGAGGGGAGGG - Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057461996 9:95271449-95271471 AGACAGAAGCAAAGATTGGAGGG + Intronic
1057469052 9:95341560-95341582 AAAGTGAAGCAGGGACAGGATGG - Intergenic
1057556514 9:96092581-96092603 AAAGAAAAGAAGAGAGAGAAAGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057806400 9:98222927-98222949 AGAGAGAACCAGAGAAAGGATGG - Intronic
1057944578 9:99314175-99314197 AGAGAGAAAGAGAGAGAGGAGGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058026895 9:100150917-100150939 TAAGAGAACCAGAGAGGGGATGG + Intronic
1058111094 9:101030946-101030968 AAAAAGAAGCAGGGGGTGGGGGG + Intronic
1058171576 9:101687407-101687429 TAAGAGTACCAGAGGGTGGATGG + Intronic
1058215886 9:102232534-102232556 CAAGAGCAGCACAGAGTGGCGGG - Intergenic
1058322948 9:103657442-103657464 AAAGAGAGACAGAGTGTGAAGGG - Intergenic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058671980 9:107367565-107367587 AAAGAGGAGGAGAGAGAGGCCGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059098717 9:111447946-111447968 AAAGAAAGGCAGAGAGGGAAAGG + Intronic
1059450191 9:114366713-114366735 GAAGAGAAGAGGAGAGGGGAAGG + Intronic
1059708556 9:116846394-116846416 AAAGGGAAGCAGAGAGTGAAAGG + Intronic
1060096675 9:120797063-120797085 AAAGAGAAAGAGAGAGAGCAAGG + Intergenic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060554549 9:124501542-124501564 AAAGAGCAGGAGAGAGGGGGTGG + Intronic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1060759216 9:126234270-126234292 AAAGGGACGCAGAGCATGGAGGG + Intergenic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060933033 9:127500837-127500859 GAAGAGAAGAAGAGAGTGTGTGG + Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061456638 9:130703026-130703048 AAGGAGACACAGAGAGGGGAAGG - Intronic
1061510021 9:131054757-131054779 AAAAAGAAAGAGAGAGGGGAAGG + Intronic
1061546993 9:131310106-131310128 AAACAGAGGCAGAGAGTGGCGGG - Intergenic
1061619118 9:131799497-131799519 AAAGGGAGGCAGAGAGTGAGAGG + Intergenic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062080858 9:134622650-134622672 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080889 9:134622751-134622773 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080920 9:134622850-134622872 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185513648 X:681601-681623 AAAGAGCAGGAGAGAGAGAAAGG + Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185595835 X:1306255-1306277 ACAGAGAAACAGAGAGAGGGAGG + Intronic
1185604604 X:1360868-1360890 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604609 X:1360892-1360914 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604614 X:1360916-1360938 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604624 X:1360962-1360984 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604629 X:1360986-1361008 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604639 X:1361032-1361054 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604644 X:1361056-1361078 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604649 X:1361080-1361102 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604654 X:1361104-1361126 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604659 X:1361128-1361150 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185632528 X:1525425-1525447 AGACAGAGGCAGAGATTGGAGGG + Intronic
1185683974 X:1911695-1911717 AGAGAGAGGAAGAGAGAGGAGGG - Intergenic
1185714435 X:2330053-2330075 AGAGAGAAGCAGAGAGACGGCGG + Intronic
1186367559 X:8911278-8911300 AAAGAGAAAGAGAGAAAGGATGG + Intergenic
1186753223 X:12643092-12643114 AAAGAGAAGGAGCCATTGGAGGG + Intronic
1186814549 X:13223421-13223443 AAAGAGAAGAAGAGAAGGAAAGG - Intergenic
1187018331 X:15352729-15352751 AAAGAAAAGCCCAGAGTGGTTGG - Intronic
1187075823 X:15933468-15933490 AAAAAGAATGAGAGAGTAGATGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187272482 X:17791740-17791762 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1187319577 X:18227696-18227718 AGAGAGAAAAAGAGAGAGGAGGG + Intergenic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187566094 X:20451126-20451148 AATGAAAAGCAGAGAGATGATGG - Intergenic
1187946770 X:24433757-24433779 AAAGAAAAGAAAAGAGTAGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188436000 X:30159318-30159340 CAAGAGAGACAGAGAGTGTAGGG + Intergenic
1188840471 X:35011000-35011022 AAAGAGGAGAAAAGAGGGGAGGG + Intergenic
1189143771 X:38635117-38635139 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189481119 X:41393090-41393112 CAAGAGAAGCTGAGAGAGGCAGG + Intergenic
1189518647 X:41742342-41742364 CAAGTGAAGCAGAGAAGGGAAGG - Intronic
1189552889 X:42112013-42112035 AAACAGTAGTAGAGAATGGATGG + Intergenic
1189775147 X:44463945-44463967 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1189775839 X:44469710-44469732 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1189926188 X:45958067-45958089 TAAGAGAGGGAGAGAGTTGAAGG + Intergenic
1190049768 X:47141034-47141056 AGAGAGAAGCAGAGAGGACAGGG + Intergenic
1190253994 X:48748733-48748755 AACAAGATGCAGAGAGTGCAAGG + Intergenic
1190322893 X:49188798-49188820 AAAGAAAGGCAGAGATTGGGGGG - Exonic
1190430750 X:50375889-50375911 AAACTGATGGAGAGAGTGGACGG - Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1191895674 X:65989989-65990011 AAAGAGAAGGATAGATAGGAAGG + Intergenic
1192031485 X:67517764-67517786 AAAGAGGTTCAGAGAGGGGAAGG + Intergenic
1192093153 X:68182388-68182410 AGAGAGAAAGAGAGAGGGGAAGG + Intronic
1192202957 X:69078519-69078541 AAAGAGCAGAGGAGGGTGGAGGG - Intergenic
1192638250 X:72841044-72841066 AAAGAGAAAGAGAGAGAGAAAGG + Intronic
1192643464 X:72879768-72879790 AAAGAGAAAGAGAGAGAGAAAGG - Intronic
1192659093 X:73022788-73022810 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193251619 X:79297838-79297860 AAAGAAGAGCAAAGAGTGAAGGG + Intergenic
1193364027 X:80608885-80608907 ACAGAGAAGAAGAGAAAGGATGG + Intergenic
1193600384 X:83503334-83503356 AAAGAGAAACTGAGACTGGACGG + Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195031002 X:100927834-100927856 ACAGGGAAGCCGAGAGTGGGAGG + Intronic
1195036794 X:100977355-100977377 AAAAAAAAGAAGAGAGTAGAAGG - Intronic
1195594451 X:106672852-106672874 AAAGGGAAGCAAAGAGGGGGAGG - Intronic
1195664299 X:107414844-107414866 AAAAAAAAGAAGAGAGTCGATGG + Intergenic
1195759296 X:108228652-108228674 AAAGAGAGGTACAGAGTGAAGGG + Intronic
1195850754 X:109279475-109279497 AAAGAGAAACAGAGAGAGAGAGG - Intergenic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196099670 X:111834454-111834476 AGAGAGAGACAGAGAGGGGAGGG - Intronic
1196304056 X:114080099-114080121 AGAGAGAGGGAGAGAGTGAAAGG - Intergenic
1196577685 X:117339176-117339198 TAAGAGAGGTAGAGATTGGAAGG + Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196734546 X:118973130-118973152 AAAGAGAAGCAGAGACCCGAGGG + Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197240211 X:124115392-124115414 AAAAAGAATAAGAGAGGGGAGGG - Intronic
1197270209 X:124417194-124417216 AAAGAGAAGAAAAGAGTTGAGGG - Intronic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197730329 X:129804303-129804325 AAAAAGAAGCAGACAGGAGAGGG + Exonic
1198264245 X:134994722-134994744 AAAGAGAAAAAGAAATTGGAAGG + Intergenic
1198323423 X:135542528-135542550 AGAGAGAAGGAGAGAAGGGAGGG + Intronic
1198327188 X:135585433-135585455 AAAGGGAAGGAGGGAGAGGAAGG + Intergenic
1198380547 X:136079181-136079203 AAAGTGGAGAAGAGAGTAGAAGG + Intergenic
1198493153 X:137163952-137163974 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1198505645 X:137298480-137298502 AAAAAGAAGCTTAGAATGGAAGG - Intergenic
1198683972 X:139208372-139208394 TAAGAGCAGCAGAGACAGGATGG - Intronic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1198859340 X:141052917-141052939 AGAGAGATTCAGAGAGGGGATGG - Intergenic
1198868651 X:141152886-141152908 AAAGATATGGGGAGAGTGGATGG + Intergenic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1198903355 X:141534475-141534497 AGAGAGATTCAGAGAGGGGATGG + Intergenic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1199061694 X:143363290-143363312 AAAGAGAAGCACAGAGCAAAGGG - Intergenic
1199139100 X:144289112-144289134 AGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1199171619 X:144740264-144740286 AAAGAGAGAGAGAGATTGGATGG + Intergenic
1199223990 X:145350791-145350813 AAAGAATAGCACAAAGTGGAAGG + Intergenic
1199316567 X:146385482-146385504 GAAGAGAAACAGAGAGAGTAAGG + Intergenic
1199506041 X:148562720-148562742 AAAGAGAGGAAGAGAGAGGAAGG - Intronic
1199598811 X:149528444-149528466 AAAGAGAAAAAGAGAGGGGAAGG - Intronic
1201146336 Y:11067237-11067259 GAAGAGAGGGAGAGAGAGGAAGG + Intergenic
1201341934 Y:12943501-12943523 AAAGTGAAAGAGAGAGGGGAGGG - Intergenic
1201638594 Y:16153694-16153716 ACAAAGAGGCAGAGACTGGAAGG - Intergenic
1201681329 Y:16647002-16647024 AAAGAAAGGAAGAGAGAGGAAGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1202013800 Y:20378875-20378897 AAAGAGAAAAAGAGAAGGGAAGG + Intergenic