ID: 1056126231

View in Genome Browser
Species Human (GRCh38)
Location 9:83538383-83538405
Sequence GCCCGCCGCGCCCCGGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056126231 Original CRISPR GCCCGCCGCGCCCCGGCCGC TGG (reversed) Exonic
900245107 1:1632932-1632954 GCCGGCCGCGCCCCCTCCCCCGG - Intronic
900256338 1:1700091-1700113 GCCGGCCGCGCCCCCTCCCCCGG - Intronic
900284113 1:1891061-1891083 GCCCGCCGCGCCCATCCCGATGG - Exonic
900349265 1:2227258-2227280 GCCGGCCCCGCCCCGCCCGCCGG - Intergenic
900786902 1:4655160-4655182 GAGCCCCGCGCCCCGGCCGGAGG + Exonic
900786945 1:4655288-4655310 TCCCGCCGCCCGCCGGCCGCGGG - Exonic
901019669 1:6249431-6249453 GCCCGCCGCGCGCAGCCCCCCGG + Exonic
901049673 1:6419959-6419981 GCCCGCCCCGCCCCGCCCCGCGG + Intronic
901086121 1:6613465-6613487 GCCCGCGCCGGCTCGGCCGCGGG - Intronic
901086549 1:6614743-6614765 GGCCCCCGCCCCCCGCCCGCGGG + Intronic
901836290 1:11926103-11926125 GCCCGCCGCCCGCCGCGCGCCGG + Exonic
901859132 1:12063187-12063209 GCCCGCCGCACCTGGGCTGCGGG - Intergenic
902286123 1:15409814-15409836 GCGCGCCCCGCCCCCGCCCCCGG - Intergenic
902522595 1:17029007-17029029 GCCAGCAGCGCCCAGGCCTCTGG - Intronic
902585730 1:17437952-17437974 GGCCGCCCCTCCCCCGCCGCGGG + Intronic
902585780 1:17438098-17438120 GCCTGCGCCGGCCCGGCCGCCGG + Intronic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
902916608 1:19643825-19643847 GCCCGCCGCGTCCCGGCACCAGG - Intronic
903210342 1:21814669-21814691 GCCGGGGGCGCCCCGGCCCCTGG + Exonic
903263387 1:22142999-22143021 GCGCGCCCCGGCCCGCCCGCGGG - Intronic
903883714 1:26529625-26529647 CCCCGCCGCGCCCCGAGGGCCGG - Intergenic
905137139 1:35808382-35808404 GGCCGCCTCGCCCCGGTCCCCGG - Exonic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
905390812 1:37634495-37634517 GCCCGCCGCGCCCCAGCTCCCGG + Intronic
905656957 1:39691554-39691576 GGCCGGCGAGGCCCGGCCGCAGG + Exonic
905684802 1:39900990-39901012 GCCCGCCGCCCCCTGTCCGCTGG - Exonic
905819855 1:40980417-40980439 GCGCCCCGACCCCCGGCCGCCGG - Intronic
905862673 1:41361603-41361625 TGCCGCCGCTCCCCGGGCGCCGG - Intergenic
905995877 1:42380533-42380555 GCCCGCAGCGCCACGTCCACCGG + Intergenic
906495783 1:46303053-46303075 CCCCCGCGCCCCCCGGCCGCTGG + Intronic
906545509 1:46616870-46616892 CCCCGCCACGCCGCGGCCACGGG + Intronic
906680948 1:47725205-47725227 GCGCCGCGCGCTCCGGCCGCTGG - Intergenic
907197490 1:52698359-52698381 CCCCGCCCCGCCCCCTCCGCCGG - Exonic
908360898 1:63367666-63367688 CCCCGCCGCCCGCCGGCCGCTGG - Exonic
908401204 1:63774317-63774339 GGCCGCCTCGTCCCGGCCGCTGG - Exonic
908582038 1:65525977-65525999 CCCCGCCGCCCGCCGGGCGCTGG - Intronic
908951537 1:69568109-69568131 GCCCGCTGCGCCCTGGCCCCTGG + Intergenic
910550277 1:88467165-88467187 GCCCGGCCCGGCCCGGCCCCGGG + Intergenic
911449569 1:98046056-98046078 GGCCGCTGCCCCCCTGCCGCTGG + Intergenic
912561686 1:110555721-110555743 GTCCGTCCCGCCCCGGCTGCCGG - Intergenic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915462156 1:156076739-156076761 GCCTGCGGAGCCCCGGCGGCGGG - Exonic
915463202 1:156081761-156081783 GCCGGCCGCCCCCCCGCAGCCGG - Exonic
915517484 1:156421638-156421660 GCCCGCTGAGCCCCGGCATCTGG - Intronic
915629138 1:157138287-157138309 CCCGGCCTCGCCTCGGCCGCCGG - Intronic
916651647 1:166839574-166839596 CCACCCCGCGCCCTGGCCGCTGG + Intronic
917846729 1:179026132-179026154 GCCCGCCGCGCCGGGGGCGGGGG - Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
923171444 1:231421475-231421497 CACCGCCGAGCCCTGGCCGCCGG + Exonic
923372335 1:233327327-233327349 TCCCACCCCGCCCCCGCCGCAGG - Intergenic
923490258 1:234478336-234478358 GCCCGCCTCGCGCGCGCCGCGGG + Exonic
1063429634 10:5977465-5977487 GGCAGCCGCGCGCCCGCCGCGGG + Exonic
1063639283 10:7814511-7814533 GCCCACCCCGCCCCAGCTGCAGG - Intergenic
1063664713 10:8054455-8054477 GCCCGCCGCCCCTCCGCCGGCGG + Intronic
1064392467 10:14953858-14953880 GCCCCCAGCGCCCCGGGAGCGGG + Intronic
1064418284 10:15168829-15168851 GCCGGCCCCGCCCTGCCCGCCGG + Intergenic
1065025289 10:21534817-21534839 GGCCGGCGCGCCCCGGCGGGCGG - Intronic
1065342825 10:24723176-24723198 CGCCGCCGCGCTTCGGCCGCCGG - Intronic
1065342896 10:24723402-24723424 CCCCGCCGGGCGCCCGCCGCGGG + Intronic
1065637230 10:27744491-27744513 GCCTGCCGCGCACCGGCGTCAGG + Intronic
1066135915 10:32446157-32446179 GACCGCCGGGCACCCGCCGCCGG - Exonic
1066180631 10:32958047-32958069 TCCCGGCGCGGCCCGGCCGGCGG + Intronic
1069673890 10:70233431-70233453 GCGCTCCCCGCCCCGCCCGCCGG - Intronic
1070140144 10:73732788-73732810 GGCAGCCGGGCCCCAGCCGCAGG - Intergenic
1070162526 10:73874621-73874643 GCCCGCCCCGCCCCGCCCCCAGG + Intergenic
1070768473 10:79069443-79069465 GGCCGCCGGGCCTCGGCCCCCGG - Intronic
1071309459 10:84328834-84328856 GCCCGCCGCGACCCCGGCCCCGG - Intronic
1071618085 10:87094640-87094662 GCCCGCCGCCGCCCCGCAGCCGG - Exonic
1072656663 10:97334626-97334648 GCCCGCAGCTCCGCGCCCGCGGG - Exonic
1073147891 10:101292348-101292370 GCAGGCCGGGCGCCGGCCGCTGG - Intergenic
1073207423 10:101776284-101776306 GGCCGCCCCGCCCCCGCCCCGGG - Intronic
1073265630 10:102226686-102226708 CCCCCTCGCGCCCCGGCCCCGGG - Intronic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1074801515 10:117005282-117005304 GCCCGCCCCGCCCCGCCTGCAGG - Exonic
1075022232 10:118960406-118960428 GCCCTCCCCGCCCTGGCCCCAGG + Intergenic
1075031949 10:119029763-119029785 GCGCGCCGCCTCCCCGCCGCCGG - Exonic
1075393782 10:122112827-122112849 GCCTGCCGCTCTGCGGCCGCGGG + Intronic
1075438384 10:122461402-122461424 GCCCGCCCTGCCCCCTCCGCGGG + Intergenic
1075519413 10:123135175-123135197 GCCCGCCGCCCCCACGCAGCTGG - Intergenic
1076838365 10:133032506-133032528 GCCCTCTGCGCCCAGGCCTCTGG - Intergenic
1076868919 10:133183168-133183190 GCCGCCCGCGCCCACGCCGCTGG - Intronic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1076878800 10:133230266-133230288 GCGCGCCGCGCCCCAGCCCCGGG + Exonic
1076878855 10:133230405-133230427 GCCCGCCTCGCCCAGCGCGCTGG + Exonic
1077051449 11:568673-568695 CCCCGCCGCGCCCTCGCAGCTGG - Intergenic
1077093533 11:789991-790013 GCCCCGCCCGCCCCGCCCGCCGG + Intronic
1077151511 11:1075019-1075041 GCCCGCCTCGCCCTGCCCCCAGG - Intergenic
1077327380 11:1969597-1969619 GCCCGCCGGGTCCTGGCCTCAGG - Intronic
1077505773 11:2929475-2929497 CCCCGCCCCGCCCCGGCCCTCGG + Intergenic
1078216318 11:9314724-9314746 CCCCGCCCCGGCCCGCCCGCGGG + Exonic
1079128484 11:17734750-17734772 GCCCGCCGCTCTCCGGACACGGG - Intergenic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1080517650 11:33039194-33039216 GCGCGCCGCATCCCAGCCGCTGG - Intergenic
1080551453 11:33376541-33376563 GCCGGCCACGGCCCGGGCGCCGG - Intergenic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1081981596 11:47270193-47270215 GCCCGACGTCCCCCGGCAGCGGG - Intronic
1082807690 11:57460906-57460928 GCCCTCCGCTCTCCCGCCGCTGG - Intronic
1083883300 11:65558631-65558653 CCCCGCCCCGCCCCGCCCGGAGG - Intronic
1083901771 11:65646789-65646811 GCGCGCGGCGCCCGGGGCGCGGG + Exonic
1084070016 11:66728035-66728057 CCCCGGCTCACCCCGGCCGCCGG + Intronic
1084070088 11:66728228-66728250 GCCCGTCGCGGCCGGGCTGCAGG - Intronic
1084147533 11:67273013-67273035 GCCCGCCGTGCCCCGCCTGCTGG - Intronic
1084265617 11:68003873-68003895 GCCCGCCCCGCCCCCGCCGGGGG + Intronic
1084267150 11:68010905-68010927 GCCAGCCCCGCCCCGCCTGCAGG + Intronic
1084273031 11:68039085-68039107 GCGCGCCGCGCCTCCGCTGCTGG - Exonic
1084891228 11:72238067-72238089 GCCTGCCTCGCCCAGCCCGCTGG - Exonic
1084891742 11:72240127-72240149 GCCCGCCGCGCCCTTGGCGCTGG + Exonic
1084952979 11:72676936-72676958 GCAGGCCCCGCCCCGGCCACAGG + Intergenic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085294829 11:75425479-75425501 GGCCGCCGCGCCCCTCCCGGAGG - Exonic
1086541556 11:87918057-87918079 GCCCCCCGCCCCCCAGCCTCAGG + Intergenic
1086590410 11:88508824-88508846 GCCGCCTGCGCCCCTGCCGCGGG + Exonic
1088481075 11:110296732-110296754 CCCCGCCCCGCCCCTCCCGCAGG + Intergenic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1089540680 11:119187625-119187647 GCCCCCCGGGGCCCGGCTGCTGG + Exonic
1089622221 11:119728681-119728703 GCCCACCCCGCCCCGGCCGACGG - Exonic
1202810362 11_KI270721v1_random:24777-24799 GCCCGCCGGGTCCTGGCCTCAGG - Intergenic
1091888074 12:4031260-4031282 GCCCGCCGCGCCCCCGCCCGGGG + Intergenic
1092155381 12:6278751-6278773 CCCGGCCGCGCCCTGGCCGCCGG - Intergenic
1092204487 12:6606955-6606977 GCCCCCCGCGTCCCTGCCTCCGG - Intronic
1092462344 12:8697847-8697869 GCCCGCCGCGCCGCGGCGCCAGG + Intronic
1094199179 12:27779965-27779987 GCCCGCGGGACCCCAGCCGCCGG - Intergenic
1095440829 12:42237854-42237876 GCGCGCCGCGCTCCGGCTGAGGG + Intronic
1096475617 12:51907286-51907308 GCCCGCAGCTCCCGGGTCGCTGG - Intronic
1096551836 12:52378206-52378228 GCCCGGGTCGCCCCGGCCACTGG - Exonic
1096784420 12:54009068-54009090 GCCGCCCGCGCCCCAGCCCCGGG + Intronic
1096983630 12:55743160-55743182 GCCCGCCGCCCCCGGCCCCCCGG + Intergenic
1100977962 12:100142330-100142352 GCCCGCCGCGCTCCGCACTCCGG + Intronic
1101437881 12:104679644-104679666 GGCCGCCGAGCCCCAGCTGCAGG + Intronic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1102854152 12:116278094-116278116 GGCCGCCGCGCCACGCCAGCCGG - Intergenic
1102933886 12:116881380-116881402 TGCCGCCGCGCTCCAGCCGCCGG + Exonic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1104030859 12:125065252-125065274 CCCCCACGCCCCCCGGCCGCGGG + Intergenic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105000600 12:132687676-132687698 GCCGGCCGCGTCCAGGCTGCGGG + Exonic
1105871909 13:24512787-24512809 GCCCGCCCAGCCCCGGGGGCAGG - Exonic
1106517250 13:30465702-30465724 ACCCGCCGGCTCCCGGCCGCGGG + Intronic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1108227523 13:48304145-48304167 TCCCGCCGGGACCCGGCCCCTGG - Intronic
1110356752 13:74575887-74575909 GCCCGCCCCGGCCCGGCCCCAGG + Intergenic
1110725379 13:78816850-78816872 GCCCGCCGCGGGCCTGCAGCTGG - Intergenic
1111006636 13:82258058-82258080 GGCCGGCGCGGCCGGGCCGCAGG + Intergenic
1111354275 13:87079188-87079210 GCCCGCCCCACCACAGCCGCCGG - Intergenic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112693019 13:101917051-101917073 GCCGGCGGCTCCCCGGGCGCCGG + Intronic
1113768299 13:112894246-112894268 CCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1113949966 13:114066388-114066410 GCCTCCCGCTCCTCGGCCGCTGG - Intronic
1114674240 14:24430218-24430240 GCCCGGCCCGGCCCGGCCCCTGG + Intronic
1115119859 14:29927143-29927165 GCCAGCCGAGCCCCGGGAGCCGG + Intronic
1115203327 14:30875391-30875413 GCCCGCTGAGCGCCGGCAGCAGG + Intronic
1115545548 14:34462354-34462376 CCCGCGCGCGCCCCGGCCGCCGG + Exonic
1115566648 14:34630231-34630253 GCCCGCCCCGTCCCCGGCGCTGG + Intergenic
1115689341 14:35826845-35826867 GCCCGCCCCGCCCCGCCGCCGGG - Intronic
1117545901 14:56794723-56794745 GGCCGCCGCCCCCCGGAAGCGGG - Intergenic
1117978535 14:61321160-61321182 CCCCGCCGTGCCCCCGCCTCCGG + Intronic
1118627815 14:67674881-67674903 GCCCGCCCCTCGCCGGCCGGCGG - Intronic
1118809009 14:69260394-69260416 CCTCTGCGCGCCCCGGCCGCCGG - Exonic
1119333012 14:73809563-73809585 GCCCAGCGCTCCCCAGCCGCGGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119786887 14:77320818-77320840 GCCCGCCCCGCCCCGAGCCCGGG - Exonic
1122066039 14:99175093-99175115 GCCCCCCGCGCCCGGGACCCCGG + Exonic
1122131270 14:99605364-99605386 CCCCGCCCCGCCCCGCCTGCTGG - Intergenic
1122736760 14:103847764-103847786 GTCCGCCCCTCCCCCGCCGCCGG - Intergenic
1122736856 14:103848047-103848069 GCCCCCCGCGCCCCTCCCACTGG - Intergenic
1122978562 14:105181088-105181110 GTCCCCCGCGCCCCCGCCGGCGG - Intronic
1122993195 14:105248599-105248621 GCCCGGCCAGGCCCGGCCGCGGG - Exonic
1202856947 14_GL000225v1_random:57841-57863 CCCCACCACCCCCCGGCCGCAGG + Intergenic
1202858425 14_GL000225v1_random:65178-65200 CCCCACCACCCCCCGGCCGCAGG - Intergenic
1124250985 15:28106558-28106580 ACCCTCCGGGCCCCGGCCTCCGG + Intergenic
1124584428 15:30991836-30991858 CCCCGCGGCGCCCCGGCTGAGGG - Intergenic
1124629562 15:31328590-31328612 GCCCGCCCCGCACCGGCCCAGGG - Intronic
1125999373 15:44194920-44194942 CGCCGCCCCGCCCCGCCCGCGGG - Intronic
1127753421 15:62067985-62068007 CCCGCCCGCGCCCCGGCCCCGGG + Exonic
1127763639 15:62164606-62164628 CCCGCCCGCGCCCCGGCCCCGGG - Exonic
1128078317 15:64841827-64841849 CCCGGCCCCGCCCCGGCCCCCGG + Intergenic
1128109615 15:65068128-65068150 GCCGGCCGCGCCCCCACCGCCGG + Intronic
1128269138 15:66293561-66293583 GCCCGCCACTCCGCGGCCGCCGG + Exonic
1128315061 15:66654976-66654998 GCCCGCCCCTCCCGCGCCGCCGG + Intronic
1128322634 15:66703705-66703727 GCCCGCCGCCCGCCGGCTCCAGG - Exonic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1128453628 15:67821210-67821232 GCCCCCCGCGGCCGGGCTGCTGG + Intronic
1129150280 15:73684183-73684205 CCCCGCCCCGCCCCGCCCCCAGG - Intronic
1129332410 15:74834466-74834488 GCCCCCCTCGCCCCAGCCTCCGG + Intergenic
1129483338 15:75844181-75844203 CCCCGCCCCGCCCCGGTCCCGGG - Intronic
1132365086 15:101251457-101251479 GCCCGCGCCGCTCCGCCCGCCGG + Exonic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132683808 16:1154046-1154068 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1132869291 16:2108560-2108582 GCGCTGGGCGCCCCGGCCGCTGG + Exonic
1133784343 16:8963336-8963358 GCTCGCCGCCGCCCGCCCGCCGG - Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134956629 16:18385121-18385143 GCGCCGGGCGCCCCGGCCGCTGG + Intergenic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136110969 16:28063511-28063533 GCCCGCCGCGCCCCGGGGCTCGG + Intergenic
1136779005 16:32885611-32885633 CCCGGCCGCCCCCCGGCCCCCGG - Intergenic
1136891613 16:33975907-33975929 CCCGGCCGCCCCCCGGCCCCCGG + Intergenic
1137531755 16:49282386-49282408 GCGCCCTGCACCCCGGCCGCCGG - Intergenic
1137655364 16:50153973-50153995 GCCCGGCGGGCCCAGGCCCCGGG - Exonic
1137787651 16:51151633-51151655 GGACTCCGCGGCCCGGCCGCCGG + Intergenic
1137988761 16:53131405-53131427 GCCCGCCCGACCCCGGCCCCGGG - Intronic
1138105877 16:54286938-54286960 CCCCGCCCCGCCCCGCGCGCGGG - Intergenic
1138514565 16:57528985-57529007 GCCCCCCGCGCCCGCGCTGCTGG - Exonic
1139570106 16:67806462-67806484 GCCCCCAGCGCCCCCGCCGGAGG + Exonic
1139853798 16:69965484-69965506 CCCCACCGCCCCCCGGCCTCGGG - Intergenic
1139882776 16:70188397-70188419 CCCCACCGCCCCCCGGCCTCGGG - Intergenic
1140098529 16:71895333-71895355 GTCTGCCGTGCCCCCGCCGCGGG + Intronic
1140369734 16:74407122-74407144 CCCCACCGCCCCCCGGCCTCGGG + Intergenic
1140660825 16:77190401-77190423 GCCCGACGCCCCCGGTCCGCCGG - Intergenic
1141709398 16:85689134-85689156 GCCGGCCCCGCCCCGGCCCGCGG + Intronic
1141828540 16:86497196-86497218 GCCGATCGCGCCGCGGCCGCCGG - Intergenic
1141828633 16:86497617-86497639 GCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1141989546 16:87602400-87602422 GACCGCCGCGCTCCGGGGGCGGG + Intronic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142234362 16:88914961-88914983 CCCCACCCCGCCCCGGCAGCGGG - Intronic
1142349886 16:89575194-89575216 CCCCGCCCCGCCCCGGCCTCGGG + Intergenic
1142374973 16:89701996-89702018 GCCCCAGGCGACCCGGCCGCGGG + Intergenic
1203081416 16_KI270728v1_random:1147700-1147722 CCCGGCCGCCCCCCGGCCCCCGG - Intergenic
1142638220 17:1270691-1270713 CTCCGCCTCGCCCCGGCTGCAGG - Exonic
1142672227 17:1492504-1492526 GGCCGCGGTGCCCAGGCCGCTGG - Exonic
1142711143 17:1724752-1724774 CCCCGCCGCGCCCGGAGCGCAGG + Intronic
1142737274 17:1908779-1908801 ACCCGCCGCGCCCCGCCGACAGG - Intergenic
1143106806 17:4534236-4534258 GTCCGCCCAGCCCCAGCCGCAGG - Intronic
1143139175 17:4731293-4731315 GCCCGCTGCGCCTCAGCCACAGG - Intergenic
1143750353 17:9022579-9022601 GCGCGCCGGGGGCCGGCCGCAGG - Exonic
1144338998 17:14297574-14297596 GCCCTTCGCGCCCGGGCCGCTGG + Intergenic
1144829015 17:18121483-18121505 GCCCGCCAGGCCCCGGCCCTGGG - Exonic
1145765507 17:27456258-27456280 GCCTGCCTCGCCGCGGCCGCCGG + Intergenic
1145765546 17:27456346-27456368 CCACGCCGCGCACCTGCCGCCGG - Intergenic
1145881748 17:28357411-28357433 GCCCGGCGGGCCCTGGCCGTGGG - Exonic
1146058691 17:29593534-29593556 GCCCCCCGCCCCGCGGCCCCGGG + Exonic
1146079159 17:29761461-29761483 GCCCGTCCCGCCCCGGACGCGGG - Intronic
1146183317 17:30710247-30710269 GCGCGCCGCGCGCCGGCCCCGGG + Intergenic
1146229486 17:31095281-31095303 CTCCGCCGCCCCCCGGCCGCGGG + Exonic
1146445297 17:32928094-32928116 CGCCCCCGCGCCCCGGCCCCCGG - Exonic
1147006397 17:37407107-37407129 GCCCGCCGCTGCCCGCCCGCCGG - Intronic
1147015674 17:37489830-37489852 GCGCGGCCCGCCCCGGGCGCGGG + Exonic
1147720398 17:42536319-42536341 GCCTGCCGCGCCCCCGGCCCCGG - Exonic
1148060129 17:44830324-44830346 TCCCGCCGCGGCCCGGGAGCGGG + Intronic
1148262033 17:46192889-46192911 GCCCTCGGCGCCCAGGCCGGGGG - Intronic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148561810 17:48610718-48610740 GCCCGCCATGCCCCCCCCGCCGG + Exonic
1148562580 17:48614339-48614361 GGCCTCCTCGCCCAGGCCGCTGG + Exonic
1148768987 17:50056198-50056220 GACGGCGGCGACCCGGCCGCTGG + Intronic
1148787815 17:50154029-50154051 GCCCTCAGCGCCCTGGGCGCAGG + Intergenic
1148911313 17:50944543-50944565 GCCCTCCCCGGCCCGACCGCGGG - Intergenic
1148945596 17:51259893-51259915 GCCCGCGGCGCCCCCTCCCCGGG + Exonic
1149610389 17:57954958-57954980 GCCCCCCGCGCCCGGGGCCCGGG + Intronic
1149682208 17:58514474-58514496 GCCCGCCGCATCCCGGCTGCGGG + Intronic
1150239946 17:63622921-63622943 GCGCGCCGCGGCCCGGGCGGGGG + Intronic
1150373509 17:64661885-64661907 GCCCCCGCCGCCCCCGCCGCCGG - Exonic
1150830264 17:68512527-68512549 GCCCGCCGCCGCCCGTCCCCAGG + Exonic
1151570641 17:74923773-74923795 GCCCTGCCCGCCCCCGCCGCCGG - Intergenic
1151612171 17:75183155-75183177 GCCAGGCGCGCCCCCGCGGCGGG - Intergenic
1152245616 17:79183231-79183253 CCCCGCCCGGCCCCGGCCCCCGG - Intronic
1152357349 17:79813545-79813567 GCCCGCCCCCCTCCGGCCGCCGG - Intergenic
1152396416 17:80036033-80036055 CCTCGCCGCGTCCCGGCCTCGGG + Intergenic
1152468051 17:80476705-80476727 CCCCGCCGCGCCGCGGGCCCGGG - Intronic
1152690736 17:81716617-81716639 GCCCGCCCCGCCCGGCCCTCAGG - Intronic
1152711184 17:81871147-81871169 GCCCGCCGAGACCCTGCCGCGGG + Intronic
1152714343 17:81891359-81891381 GCCGGCCGCGCCGCGGGCGATGG + Exonic
1152781994 17:82230758-82230780 TCCCGCCCCGCCCCTGCCCCAGG - Intronic
1153219137 18:2847093-2847115 GCGGGCGGCGCCCTGGCCGCCGG + Exonic
1153794472 18:8609676-8609698 GCCCGCCGCCGCCCGCCCCCCGG - Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1153900544 18:9614337-9614359 GCCCGCCTCCCCCCCGCCCCGGG + Intronic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1156171836 18:34494356-34494378 CCCCGCCGCCCCCCGTCCCCGGG - Intronic
1156350369 18:36297485-36297507 CCCCGCCCCGCCTCCGCCGCCGG + Intergenic
1156452431 18:37274454-37274476 TCACGCGCCGCCCCGGCCGCAGG - Exonic
1157529531 18:48409493-48409515 GCGCCCCGCGCCCGCGCCGCCGG + Intronic
1157706797 18:49813956-49813978 CGCCGCCGCGCCCCGCCCACAGG - Exonic
1158976425 18:62715438-62715460 GCCCTCCCCGCCCGGGTCGCGGG - Exonic
1160163166 18:76491163-76491185 CTCCGCCGCGCCTCGGCCCCCGG + Intronic
1160204634 18:76822694-76822716 GCGGGCCCCGCACCGGCCGCCGG - Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160719247 19:590199-590221 GCTCGCCGCGCCCGGGGTGCCGG - Exonic
1160747718 19:719758-719780 GCCTGGCGGGCCCCGCCCGCAGG + Intronic
1160774903 19:850914-850936 GCCCGCCCAGCCCCTGCCTCAGG + Intergenic
1160814439 19:1028684-1028706 CCCCCCCGCTGCCCGGCCGCCGG - Intronic
1160853536 19:1206016-1206038 GCCTGCGCCGCCTCGGCCGCCGG + Intronic
1160858168 19:1226657-1226679 CCCCGCCGCGCCCCACCTGCAGG - Exonic
1160897015 19:1407846-1407868 GCCCGCCGCTCCCCGCCGCCCGG + Intronic
1160904586 19:1446246-1446268 ACCCGCCGCGCCCCGCCCCTCGG - Intergenic
1160937752 19:1605254-1605276 GCCCGGCCCGGCCCGGCCCCCGG + Intronic
1160947874 19:1652014-1652036 GCCCCCCGCGCCCCCGCCCGGGG + Intronic
1161031860 19:2061342-2061364 GCGCCCAGAGCCCCGGCCGCCGG - Intergenic
1161073932 19:2275925-2275947 GCCCTCGGCGTCCCGGACGCGGG - Exonic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161210441 19:3062651-3062673 GCCCGGCCCGCCCCCGCCCCGGG + Intronic
1161215819 19:3094597-3094619 CGCCGCCGCCCCCCGGCCCCCGG - Exonic
1161231955 19:3178891-3178913 GCCCCCCGCGCCCGGCCAGCCGG - Exonic
1161233231 19:3186003-3186025 GCCCCGCGCGGCCCCGCCGCCGG + Exonic
1161265181 19:3360398-3360420 GCCCGGCGCGCCCCAGGCCCTGG + Intronic
1161396629 19:4047983-4048005 GGGCGCCCCGCCCCGGACGCGGG + Exonic
1161425008 19:4198466-4198488 GCCCCCCGCGCCCCGCGCCCCGG + Intronic
1161535593 19:4817063-4817085 GCTCCCCGCGCCCCGGCACCTGG + Exonic
1161702921 19:5804948-5804970 GCCCTCCCCGCCCCCGCCGGAGG - Intergenic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162373256 19:10291166-10291188 GGCCACCGCGCTCCGGCCGAGGG - Exonic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163159745 19:15457527-15457549 GCCCCACGCGCGCCTGCCGCCGG - Exonic
1163314972 19:16535541-16535563 CCCCGCCGCGCCCATCCCGCCGG - Exonic
1163442501 19:17328890-17328912 GCTCGCCGCGGCCCAGGCGCCGG + Exonic
1163585486 19:18161377-18161399 GCCAGCCGCGCCCCGGCCCTGGG + Exonic
1163666692 19:18606865-18606887 GCCCGCCGCCCCCCCGGGGCCGG - Intronic
1164615774 19:29665946-29665968 CCCCGCCGCGCCCCTGCCCAGGG - Intronic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
1165157279 19:33796262-33796284 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1166077260 19:40421043-40421065 GCCCGCCCCTTCCCGGCCCCTGG + Intergenic
1166367307 19:42284206-42284228 GCCCCGCGCGTCCCGGCTGCCGG - Intronic
1166981955 19:46636214-46636236 GCCCGCCCCGCCCCCTCCCCTGG + Intergenic
1167040283 19:47019753-47019775 GCCCGCCGCGTCTCCGCCCCCGG - Intergenic
1167414359 19:49362380-49362402 GCCCGCGGCTCCCCAGCCCCAGG - Intronic
1167509910 19:49890600-49890622 CCCCGCCCCGCCCCGCCTGCAGG - Exonic
1167641879 19:50686849-50686871 GCCCGCTCCGCCCCGCCCCCGGG - Intronic
1167975775 19:53224847-53224869 GCGCTCCGGGCCCGGGCCGCTGG - Intergenic
1168305574 19:55433392-55433414 GCCCCCCGGGCCCCAGCAGCAGG + Exonic
1168314628 19:55479217-55479239 GCCCGCCTCCCCCTGGCCTCCGG - Intronic
925169654 2:1743416-1743438 GCCCGGCTCGCTCCGGGCGCAGG + Intronic
925609383 2:5691535-5691557 GCGCGCCCCGCCCCGGGCGGGGG - Intergenic
925927158 2:8678781-8678803 GCTCGCCCAGGCCCGGCCGCCGG - Intergenic
926101845 2:10122903-10122925 GCCCGCAGCGCCCTCCCCGCGGG - Intronic
926130825 2:10302512-10302534 GCCCCCCGCCCCCACGCCGCAGG - Intergenic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
926801846 2:16665931-16665953 AGCCGCCCCGCCCCGGCCCCGGG + Intronic
927156678 2:20224878-20224900 GCCTGCCGCTCTCCCGCCGCCGG - Exonic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927714051 2:25341441-25341463 GCCCGGCTCGCCGCTGCCGCAGG - Intronic
927881432 2:26692635-26692657 GCCCCCCGCCCCCCGCCCGCAGG - Intergenic
928094132 2:28393606-28393628 GCCGGCCGCGCCGCGGGCTCTGG - Exonic
928904810 2:36356937-36356959 GCCCGCGGCGCCCCCACCTCGGG - Intronic
928998729 2:37324818-37324840 GCCCCCCGCCCTCCGGCCCCAGG - Intergenic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
932607623 2:73175641-73175663 CCCCGCCGGGCCCCTTCCGCCGG - Intergenic
932773231 2:74513291-74513313 CCCCGGCCCGCCCCGGCCCCCGG - Intergenic
934966869 2:98731145-98731167 GCCGGCTCCGCCCCCGCCGCTGG + Intergenic
935396945 2:102619499-102619521 GCCCGCCCCGCCCCCGCCCGCGG + Intergenic
935622856 2:105144184-105144206 ACCCCCCGCGGCCCGGCCACCGG - Intergenic
936278724 2:111120774-111120796 CCCCTCGGCGCCGCGGCCGCCGG - Intronic
936433292 2:112482316-112482338 GCGCCGCGCGCCCGGGCCGCCGG - Exonic
937917460 2:127106158-127106180 GCCACCCGCTCCCCGGCCGCCGG + Intronic
938416143 2:131105260-131105282 GCGCGGCGGGCCCCGGCCGGTGG - Exonic
942565906 2:177264624-177264646 CCGCGCCGCGCCTCGGCAGCCGG - Exonic
943725245 2:191245739-191245761 GCCCGCTGACCCCCGCCCGCAGG - Intronic
945955413 2:216081868-216081890 CCCGGCCCCGCCCCGCCCGCCGG + Exonic
946856760 2:223957630-223957652 GCCCGCCGCCGCCCGTGCGCCGG + Exonic
947399064 2:229714395-229714417 CCCCGCCGCGCCCAGGCGCCCGG - Exonic
947651076 2:231786637-231786659 GCCCGCCCCGCCCCCGCCTTGGG + Intronic
948115812 2:235493951-235493973 GCTTGCCGCCCTCCGGCCGCCGG - Intergenic
948560388 2:238847872-238847894 GCCCTCCGCGCCGGGGCCGAAGG + Intergenic
948991744 2:241559097-241559119 GCCCTCCCCGCCCCGGCCCGGGG - Intronic
1168796004 20:610433-610455 GTCCGCCGCGCCCTGGCCAATGG + Intergenic
1168869791 20:1118607-1118629 CCCCGCCCCGCCCCGTCCCCGGG + Exonic
1169065585 20:2692851-2692873 GCCCGCCGCTCCCCGGGGCCTGG - Intergenic
1169208242 20:3751889-3751911 GCCCGGCGCGTCCCGGCCAGCGG + Exonic
1170674530 20:18467043-18467065 GCGAGCCGCGCCCCGCCCACTGG + Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1170890176 20:20369233-20369255 GCCCGCCGCCGCCCGCGCGCCGG + Exonic
1171034971 20:21706963-21706985 GCCCGCCGTGCCCGGGACCCCGG - Exonic
1172101217 20:32484582-32484604 GCCCGCCCCCGCCCCGCCGCCGG + Intronic
1172252539 20:33490040-33490062 GCTGGCCCCGCCCCGCCCGCCGG - Intergenic
1172367909 20:34363724-34363746 GCCCGCGCCGGCCCCGCCGCCGG - Intronic
1172684812 20:36745815-36745837 GCTCCCCGCGCCCAGCCCGCCGG - Intronic
1172765084 20:37346646-37346668 GCCCTGCGCCCCCCGGCCCCGGG + Intronic
1173516152 20:43666985-43667007 CCCCGCCCCGCCCCGCCCCCTGG + Intergenic
1175218249 20:57402711-57402733 GGCGGCCCCGCCCCGGCCGCAGG - Intronic
1175847036 20:62064852-62064874 CCCGCCCCCGCCCCGGCCGCCGG - Exonic
1175856177 20:62122222-62122244 GCCCGCCGGGAGCCGGCCGAGGG + Intergenic
1176005598 20:62860993-62861015 CCCCGCCAGCCCCCGGCCGCCGG + Intronic
1176194470 20:63830977-63830999 CCCGGGCGCGCCCCCGCCGCCGG - Intronic
1176194619 20:63831412-63831434 GCCCACGCCGGCCCGGCCGCCGG + Intergenic
1176566740 21:8392033-8392055 GCCCGCCCCGCCCGGGACGGGGG - Intergenic
1177010916 21:15729879-15729901 CCCCGCAGAGCCCCGCCCGCCGG - Intergenic
1177834157 21:26170957-26170979 CCCCTCCGCTCCCCGGCCGACGG + Intronic
1178610313 21:34073811-34073833 CCCCCGCGCGCCCTGGCCGCGGG + Intronic
1179243833 21:39613074-39613096 GCGCCCCGCGCCCCAGCCCCGGG - Intronic
1179882726 21:44300261-44300283 GCCCGCCGAGCCCCGGGACCCGG + Intronic
1179968161 21:44818487-44818509 GCCCGCGGGGTCCCGTCCGCGGG + Intronic
1180068222 21:45423487-45423509 GCCCCCCGCCCCCCGCCCCCCGG + Intronic
1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG + Intronic
1180977252 22:19855164-19855186 GACCGCCGGGCACCGTCCGCTGG - Intergenic
1181057809 22:20268192-20268214 CCCGGCCCCGGCCCGGCCGCGGG + Exonic
1181169910 22:21002175-21002197 CCCCGCCCCGCCCCGGTGGCGGG - Intronic
1181478112 22:23180869-23180891 GCCAGCCCGGCCCCGGGCGCCGG - Exonic
1181813704 22:25421127-25421149 GCCCGCCGCGCCCCAACCTGGGG - Intergenic
1181831665 22:25564949-25564971 GCCCGCCGCGCCCCGACCTGGGG - Exonic
1182295294 22:29308625-29308647 GCCCCCAACGCCCCTGCCGCTGG + Exonic
1182445460 22:30387150-30387172 CCCCGCCCCGCCCCGGCCGCCGG + Exonic
1182697186 22:32205501-32205523 CACCCCCGCCCCCCGGCCGCGGG - Intergenic
1183093734 22:35540434-35540456 CCCCGCCTCGCCCCGGCGCCCGG - Intergenic
1183228145 22:36564284-36564306 CCCCGCCCCGCCCCGCCCCCGGG + Exonic
1183535708 22:38399175-38399197 GCCCCCCCCGCCCCCCCCGCCGG - Intergenic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1183720187 22:39557900-39557922 GCCCGCCGCCCCCCGCGCCCCGG + Intergenic
1184663745 22:45977034-45977056 GCCAGCCGCGCCCGGGCCCCCGG - Exonic
1185092490 22:48783863-48783885 GCCGGCCACGCCCCAGCCCCAGG - Intronic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185395012 22:50582437-50582459 CCCCGCCCCGCCCCAGGCGCGGG + Intronic
949414413 3:3799931-3799953 GCCGGCCGCGCCGCGGCAGGAGG + Intronic
949540165 3:5026500-5026522 CACAGCCGGGCCCCGGCCGCAGG + Intergenic
951558896 3:23946170-23946192 GCCCGCTGAGCCCCCGCGGCGGG + Intronic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
951640373 3:24829360-24829382 GTCCGCGGCGCGCCGCCCGCTGG - Intergenic
952764828 3:36944863-36944885 GCCCGCCGCGCCCTGCCCACAGG - Exonic
952816525 3:37452215-37452237 GCCGTCCGCGCCCCGGTGGCGGG + Exonic
953404660 3:42654476-42654498 GCCCGCCGCGCCCGAGGCTCTGG + Intronic
953484929 3:43286438-43286460 GCAGCCCGCGCGCCGGCCGCAGG + Intergenic
953492739 3:43364437-43364459 GCCCCCCGCCCCCCGCCCGACGG - Intronic
954131037 3:48561055-48561077 GCCTGCTGCTCCCCGGCCCCAGG + Intronic
954339256 3:49940019-49940041 TCCCGCCGTGCCCCGCGCGCAGG - Exonic
954733544 3:52685788-52685810 GACCGCCGCGCCCCGCCCCGTGG + Exonic
954912265 3:54120829-54120851 GCCAGGTGCGCCCCGCCCGCGGG - Intergenic
956178916 3:66500293-66500315 GACCGCCGCGGCCGGCCCGCGGG - Exonic
956678059 3:71753805-71753827 GCCCGCGGCGCCTAGGGCGCAGG + Intronic
956681465 3:71785322-71785344 GCCCCCCGCGCCCCCGCCTCGGG + Intergenic
957054723 3:75435002-75435024 GCCCGCCGCCCCCCTGCCAGGGG + Intergenic
961359332 3:126357258-126357280 GACCGCCGGGGCCTGGCCGCCGG - Exonic
963038435 3:141051596-141051618 ACGGGCCGCGCCTCGGCCGCTGG - Exonic
963081870 3:141402301-141402323 GCCCGGCCCGCCCCCGGCGCGGG - Intronic
963081980 3:141402673-141402695 CCCCGCCCCGCTCCGGGCGCGGG - Intronic
963133105 3:141876516-141876538 TCAGGCAGCGCCCCGGCCGCTGG + Intronic
963827648 3:149971435-149971457 GCACATCGCGGCCCGGCCGCGGG - Intronic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
966849445 3:184155597-184155619 GCAGGCCGCGCGCGGGCCGCCGG + Exonic
967684944 3:192408458-192408480 GACCGCCCCGCCCCGCCCCCCGG - Exonic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968046228 3:195625067-195625089 GCCCGCCCCGCCCCTGCCTTTGG - Intergenic
968225573 3:196969994-196970016 CACCACCGCGTCCCGGCCGCTGG + Intergenic
968308425 3:197665020-197665042 GCCCGCCCCGCCCCTGCCTTTGG + Intergenic
968640382 4:1711838-1711860 CCCCACCGCGCCCCGACCCCCGG + Intronic
969368661 4:6716429-6716451 TCGGGCCGCGCCCCGGCCCCGGG - Exonic
969371234 4:6732844-6732866 GCCCGCAGTGGCCAGGCCGCAGG + Intergenic
973293243 4:48490380-48490402 GCCCGCCGCGCCCTTGCCCTTGG - Exonic
976704615 4:88007784-88007806 GCCGCCCGCGCCCCGCGCGCCGG + Exonic
976733288 4:88284884-88284906 CCCCTCCGCGCTCCGCCCGCTGG - Intergenic
979455637 4:120922834-120922856 GCCCCCCGCGCCCCCGCAGCAGG - Exonic
980130399 4:128811709-128811731 GGCCGCTGCGCCCCCGCCCCGGG + Intronic
980913794 4:139016101-139016123 GCCCGCATCCCCCCGGCTGCTGG + Exonic
981429798 4:144645871-144645893 GCCCGCCTCGCCGCGGCCCCCGG - Intergenic
982042358 4:151409016-151409038 GCCGGCCCCGCCTCTGCCGCTGG - Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983904649 4:173169859-173169881 GGCCGCCCCGCGCCGGCTGCCGG + Intronic
984973581 4:185210418-185210440 GCCCGCCGCGCGCGGGCGCCGGG - Intronic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
985747083 5:1653808-1653830 GCCCGCCCCGCCCCTGCCTTTGG + Intergenic
985788139 5:1910678-1910700 GCCAGGCCCGCCCCGGCAGCTGG + Intergenic
986402721 5:7395871-7395893 TCCCGCTGCGCCCCGGCCCGGGG - Intergenic
986721619 5:10564444-10564466 CCGGCCCGCGCCCCGGCCGCCGG + Intronic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987696653 5:21341711-21341733 GCCCCCCGCCCCCCAACCGCGGG + Intergenic
988755553 5:34244859-34244881 GCCCCCCGCCCCCCAACCGCGGG - Intergenic
991298190 5:65103095-65103117 CCCCGCCGCGCCCCGCCTCCGGG + Intergenic
991587475 5:68215533-68215555 GCCTTCCGCCCCCCAGCCGCGGG - Intergenic
991743786 5:69710587-69710609 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991753922 5:69844648-69844670 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991795358 5:70290319-70290341 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991803547 5:70401403-70401425 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991823158 5:70585862-70585884 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991833239 5:70719768-70719790 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991887725 5:71289838-71289860 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
992042472 5:72848823-72848845 GCCCGCCGCTGACCTGCCGCGGG + Intronic
992473240 5:77077698-77077720 GCCCGGGGCGCCCCGGCGCCAGG + Exonic
992527659 5:77628366-77628388 GCCCTCCGCGCCACTGCCCCAGG + Intergenic
992530207 5:77645648-77645670 GCCCGCCCCGCCCGGCCCCCAGG + Intergenic
992563241 5:77972897-77972919 GCCCGGCGCGGCGCGGCCCCCGG + Intergenic
997301992 5:132813376-132813398 CCCCGCCGGGCCCCGGCCTTCGG - Intergenic
997454082 5:134004807-134004829 GCCCGGCGCGCTCCGCCCCCAGG + Intronic
997470562 5:134114876-134114898 GCGCCCCGCGCCCCGGCGGGCGG + Exonic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
998349752 5:141492732-141492754 CCCTGCCGCGCCTCGGCCACTGG - Intronic
999809565 5:155114930-155114952 GGCCGCCGCGCCCCCGGCTCTGG + Intergenic
1000330163 5:160199549-160199571 GCCCGCCGGCCCCAGGCCGACGG - Intronic
1000330169 5:160199563-160199585 GACAGCCGAGCCCCGCCCGCCGG - Intronic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1001401935 5:171451067-171451089 GCCGGCCGCCTCCCGCCCGCGGG + Intronic
1002190164 5:177473668-177473690 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1002350059 5:178577185-178577207 GCGCGCCGCGCCCCGGGCTCCGG - Intronic
1002638388 5:180619196-180619218 GCCCGCGGCGCCCCGCGCCCGGG + Intronic
1002662780 5:180802851-180802873 CCCCGCCCCGCCCCGCCTGCCGG - Intronic
1002662788 5:180802898-180802920 CCCCGCCGCGCCCCGCCCCCCGG + Intronic
1003035004 6:2634349-2634371 CCCCGCCACGCCGCGCCCGCAGG + Intronic
1003049335 6:2765770-2765792 GCGCGGTGCGACCCGGCCGCGGG - Exonic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003175849 6:3751813-3751835 GCCCGCGGCGCCCGTTCCGCGGG - Exonic
1003624151 6:7727264-7727286 GCCCCCGGCGCTCCGGCAGCAGG + Exonic
1003645422 6:7910273-7910295 GCCCCCCGCTCCCCGCCAGCCGG + Intronic
1004193988 6:13487738-13487760 GCGCGCTGCGCCCGGGCCCCGGG + Intergenic
1004241345 6:13925038-13925060 GCCGACCCCTCCCCGGCCGCGGG - Intronic
1005554188 6:26956632-26956654 GCCCCCCGCCCCCCAGCCGCGGG - Intergenic
1006117195 6:31781661-31781683 TCCCGCCAAGCCCCGGCCCCAGG + Intronic
1006313405 6:33277126-33277148 CCCCGCCTCGCCCCGGCGGCCGG - Exonic
1006396158 6:33788864-33788886 GCCCGCCGCGGCCTCTCCGCGGG - Exonic
1006458565 6:34145190-34145212 GCCCGCCGCGGCCCGGGCTCTGG - Intronic
1006932831 6:37697805-37697827 GGCCGCCGCGCCCCGGAGCCCGG - Exonic
1007390456 6:41547177-41547199 CCCCTCCCCGCCCCGGCCTCCGG - Intronic
1007431723 6:41780651-41780673 GCCCGCCCCTCCCCGGCTGGTGG - Intronic
1007571054 6:42891073-42891095 GCCCGCAGCGGCGCGTCCGCAGG - Intergenic
1007625382 6:43243619-43243641 CCCCGCCCCGCCCCGGCCCCGGG + Intergenic
1010752514 6:79631276-79631298 GCCCAGCGCCGCCCGGCCGCAGG - Exonic
1011044403 6:83065926-83065948 GCGCGCCCCGCCCCGGCCTCCGG - Intergenic
1011517200 6:88166816-88166838 GCCCGGCGCGCCTCGGCCTCTGG - Intergenic
1011983964 6:93419141-93419163 GCCGGCCGCGCCTCCGGCGCCGG - Intronic
1012912897 6:105137229-105137251 GCCCGCCGCCCCGCGCCCCCCGG + Intergenic
1013272851 6:108559581-108559603 GCCCGCCGAGTCCCGGCCCACGG + Intergenic
1013793690 6:113860438-113860460 GCCCGGCGCGCCCCCGGAGCAGG + Exonic
1014535621 6:122610325-122610347 GGCCGCCGCGTCCCGCCCCCAGG - Intronic
1014632495 6:123803754-123803776 GCTCGCCGCGCGCCGGCTCCGGG - Intergenic
1015749961 6:136550010-136550032 GCCCTCCCCGCCGCGGCCTCGGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017954952 6:159169708-159169730 ACGCGCCGCGCCCGGGCCCCCGG + Intronic
1018023953 6:159789631-159789653 GGCTGCCCCGGCCCGGCCGCGGG + Exonic
1018613210 6:165662674-165662696 GCCCGCCGCGCTCCCCCCGCCGG + Intronic
1019311801 7:365812-365834 CCCAGCCGCTCCCCGGCCGGCGG - Intergenic
1019343404 7:518862-518884 GCCCGTGGCGCCCCAGCCGGCGG + Intronic
1019577974 7:1746649-1746671 GCCCGCAGCACGGCGGCCGCGGG - Exonic
1019610349 7:1933581-1933603 GCCGGCCGCCCCCAGGCCTCTGG + Intronic
1019689649 7:2403563-2403585 GCCGGCCCCGCCCCCGGCGCAGG - Exonic
1019828388 7:3301756-3301778 GCCCGCCGTGTCCCCGCCGGAGG - Exonic
1020023575 7:4883451-4883473 GCCCTCCGCGCCCCGACCAGCGG + Intronic
1020106471 7:5424375-5424397 GCACTCCGGGCCCCGGCCCCCGG + Intronic
1020201169 7:6081346-6081368 CCCCGCGGCGGCCCGGCCCCCGG - Intergenic
1020204655 7:6105231-6105253 GCCCGCCCGGGCCAGGCCGCTGG + Intronic
1020274326 7:6615595-6615617 GGCCCCCGCGCCCCCGCCCCCGG + Exonic
1020727294 7:11831896-11831918 CCCCGCAGCGCCCCGGCTCCCGG + Exonic
1021510448 7:21427859-21427881 GGCCCCAGCGCCCCGGCCCCCGG + Intergenic
1021716842 7:23469256-23469278 GCCCGCCGCTCTCCGGGCCCTGG - Intronic
1021731276 7:23597681-23597703 CCCCGCCGCGCCCCCGTCCCCGG + Intronic
1022363264 7:29684659-29684681 GCCCCCGGCGCCCCGGCCGAAGG + Intergenic
1022428061 7:30285918-30285940 GCCCCCGGCGCCCCGGCAGAAGG - Intronic
1022698120 7:32729101-32729123 GCCCCCGGCGCCCCGGCGGAAGG - Intergenic
1023972375 7:45000473-45000495 CCCCGCCCCGCCCCGCCAGCTGG - Intronic
1025207900 7:57004023-57004045 GCCCCCGGCGCCACGGCCCCCGG - Intergenic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1026470948 7:70694010-70694032 GCGCGCCGAGCCCGAGCCGCCGG - Intronic
1026850355 7:73719715-73719737 CCCGGCCCCGCCCCGGCCCCCGG + Intergenic
1027151860 7:75738978-75739000 GCCCGCCCCGCCCTACCCGCGGG + Intergenic
1027152061 7:75739582-75739604 CCACGCTGCGCCCCGCCCGCGGG - Intergenic
1028709399 7:93890535-93890557 GCCCGCTGCGCCCTCTCCGCCGG + Intronic
1031966591 7:128031784-128031806 GCCCGCCGCTGCCCGGCCCCCGG + Intronic
1032087540 7:128891698-128891720 GCCAGCCTCGCCCCTGCCCCAGG - Exonic
1033299811 7:140176335-140176357 CCCCGCCGCGCCCGGGGCTCCGG - Intronic
1034228044 7:149497876-149497898 CCCCGCCCAGCCCCGCCCGCGGG + Intergenic
1034433213 7:151051122-151051144 GTCCGCCCCGCTCCGCCCGCGGG + Intronic
1034488686 7:151381587-151381609 CGCCGCCGCGCCCCTGCAGCCGG - Exonic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1034911591 7:155002748-155002770 GCCCGGCGCGCGCCCGCGGCAGG + Intronic
1035168519 7:157005469-157005491 GCACGGAGCGCCCCGGCCGGCGG - Exonic
1035431804 7:158828747-158828769 CCCAGCCCCGCCCCGGCCTCCGG - Intronic
1035522523 8:286717-286739 CCTCGCCGCTCCCTGGCCGCAGG + Intergenic
1036561443 8:9903296-9903318 GACCTCCGCGCAGCGGCCGCGGG - Intergenic
1036664560 8:10730325-10730347 GCCGGCCGTCCCCCGGCCCCCGG - Intronic
1037336883 8:17801007-17801029 CCCCTCCCCACCCCGGCCGCCGG + Intergenic
1037589954 8:20303970-20303992 CCCCGCCCCGCCCCGGCTCCGGG - Intergenic
1039996893 8:42541776-42541798 GCCCGCCCCGCCCCGGACGCGGG + Intronic
1040915703 8:52565090-52565112 GTCCGGCCGGCCCCGGCCGCGGG + Exonic
1041059395 8:54021922-54021944 GCCCGCCGCGCCCGCGTCCCCGG - Intronic
1041673616 8:60516852-60516874 GCTGGCCGCGCCCCGCCAGCCGG - Exonic
1042155562 8:65841538-65841560 GCCCGCCCTGCCGCGGCCGCCGG + Exonic
1042367335 8:67952316-67952338 GCCCGCTGCTGCCCGGCCCCCGG - Exonic
1043873852 8:85463856-85463878 GCCCGCCCCGCCCCGAGCGCGGG + Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1045277506 8:100721378-100721400 GCCCGGCGCTCACCGTCCGCCGG + Exonic
1047100161 8:121667532-121667554 CCCCGCCCCGCCCCCGCCGGGGG - Intergenic
1048472058 8:134712723-134712745 GGCCGCCGGCCGCCGGCCGCCGG - Intronic
1048553979 8:135457621-135457643 GGCCCCCGCGCTCCGGGCGCGGG - Exonic
1049608600 8:143541481-143541503 GCCCGCTCCGCCCCGCCCGCGGG - Intergenic
1049639358 8:143707630-143707652 CCCCGCCTCACCCCGGCCGCGGG + Intronic
1049746899 8:144266787-144266809 GCCCCCCGCCCCCGGCCCGCCGG - Exonic
1049761204 8:144332722-144332744 GCCGGCCCCTCCCCGGCAGCAGG - Exonic
1049761466 8:144333764-144333786 GCCCGCCCCGCCCCCGCCTCCGG + Exonic
1050873969 9:10612889-10612911 CCCCCACGCGCTCCGGCCGCCGG + Intergenic
1051774514 9:20620546-20620568 GCCCCCCGCGCCGCGCTCGCCGG - Intronic
1052991766 9:34522852-34522874 TCCCGCCGCCCCCCGCCCGCAGG - Exonic
1054695676 9:68357181-68357203 CCCCGCCGCCGGCCGGCCGCTGG - Exonic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1056154009 9:83817415-83817437 CCCCTCGGCGCCCCGGCCTCGGG - Intronic
1056243000 9:84668389-84668411 GCCCGCCGCGACCCGGGCCATGG + Intergenic
1056643410 9:88388993-88389015 CCCCGCCCCGCCCCCGTCGCCGG - Intronic
1058254861 9:102749218-102749240 GCCCCCCGCCCCCCGCCCCCCGG - Intergenic
1058885886 9:109320830-109320852 CCGCGCCGCGCGCCGGCCGAGGG + Exonic
1059375268 9:113876244-113876266 GCCCGCCCCGCTCAGGCCGGGGG - Intergenic
1060555380 9:124504984-124505006 ACCCGCCGCGCCGGGGCCGGGGG + Intronic
1060700592 9:125746912-125746934 GCTCCCCGCGGCCCGCCCGCAGG + Intergenic
1061208465 9:129177452-129177474 GCCCGCTGCGCTCTGCCCGCGGG - Exonic
1061208611 9:129178126-129178148 GCCCGGCGCGCCCCGGCGGCCGG - Exonic
1062022664 9:134326692-134326714 GCCCGCCGGCCCCCGGCCCCCGG - Intronic
1062162375 9:135087535-135087557 CCCCGCCGCCCCCTGGCTGCTGG - Intronic
1062230634 9:135479886-135479908 CCTCCCCGCGCCCCGGCCGAGGG + Exonic
1062277234 9:135736748-135736770 GCCCACGGAGCCCCCGCCGCGGG - Intronic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062362327 9:136193789-136193811 CCCCACCCCGCCCCGGCCTCCGG - Intergenic
1062461982 9:136665996-136666018 GCCCGGCCCGACCCAGCCGCGGG - Intronic
1062467378 9:136687193-136687215 GCCTGCTGCGCCACGGCGGCCGG - Exonic
1062556247 9:137114555-137114577 GCCCGCAGGGCCCCGGACCCCGG - Exonic
1062584150 9:137241521-137241543 GGCCGCCGGGCCCCCTCCGCGGG + Intronic
1062584178 9:137241581-137241603 GCCCCGCGCGCCCTGGCCGCCGG - Intronic
1062596756 9:137302987-137303009 TCCCGCTGCGCCCCGGCCCGGGG - Intergenic
1203771058 EBV:50401-50423 GCCCACCGCGGCCCCGCCGTCGG - Intergenic
1186496426 X:10015490-10015512 CGCCCCCGCGCCCCGGGCGCCGG + Intergenic
1187888119 X:23907905-23907927 GCGCGTCGCGCCCGGGCAGCGGG + Exonic
1187900910 X:24025760-24025782 GCGCCCCGCGTCCCGGCTGCCGG + Intronic
1188242667 X:27809515-27809537 GCCCGCCCCCCCCCCGCCGCCGG + Intronic
1189446657 X:41086258-41086280 GCCCGCCCAGCCCGGGCCGGAGG - Intronic
1190220366 X:48508940-48508962 TCCCGGGGCGGCCCGGCCGCCGG - Intronic
1190344234 X:49322464-49322486 GCCCGCCTCGCCCCCGCCGGAGG - Intronic
1190346422 X:49341574-49341596 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190347673 X:49532603-49532625 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190348774 X:49542159-49542181 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190349874 X:49551715-49551737 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190350979 X:49561268-49561290 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190352080 X:49570826-49570848 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190353181 X:49580375-49580397 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1190354281 X:49589922-49589944 GCCTGCCTCGCCCCCGCCGGGGG - Intronic
1190355384 X:49599446-49599468 GCCCGCCTCGCCCCCGCCGGGGG - Intronic
1195625219 X:106999925-106999947 GCCCGGCGCGCCAGGGCCGGCGG + Exonic
1195702607 X:107716423-107716445 GCCCGCCGCCCCTCTGCCTCCGG + Intronic
1197754306 X:129983709-129983731 CCCCGCCGCGCCCGGCCCGGCGG - Intronic
1198398985 X:136251445-136251467 CCCCGCCCCGCCCCGCCCACCGG - Exonic
1198767146 X:140091500-140091522 GCACGCCCCGCCCCGCCCGCCGG - Intergenic
1200100800 X:153688443-153688465 CCCGGCCGCCCCCCGGCCCCCGG + Exonic
1200292573 X:154886665-154886687 GCGCGTCGCGCTCCTGCCGCAGG - Exonic
1200339417 X:155382405-155382427 GCGCGTCGCGCTCCTGCCGCAGG - Exonic
1200347053 X:155458288-155458310 GCGCGTCGCGCTCCTGCCGCAGG + Exonic
1200787605 Y:7273903-7273925 CCCCGCCCCCACCCGGCCGCGGG - Intergenic