ID: 1056128011

View in Genome Browser
Species Human (GRCh38)
Location 9:83555387-83555409
Sequence AGCAGCAGTCTGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128003_1056128011 17 Left 1056128003 9:83555347-83555369 CCTACCCAGTGAGGGGGAATGGG No data
Right 1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG No data
1056128005_1056128011 13 Left 1056128005 9:83555351-83555373 CCCAGTGAGGGGGAATGGGATCA No data
Right 1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG No data
1056127997_1056128011 30 Left 1056127997 9:83555334-83555356 CCAGTTGGGAGGTCCTACCCAGT No data
Right 1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG No data
1056128006_1056128011 12 Left 1056128006 9:83555352-83555374 CCAGTGAGGGGGAATGGGATCAG No data
Right 1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128011 Original CRISPR AGCAGCAGTCTGGCCAAATT TGG Intergenic
No off target data available for this crispr