ID: 1056128937 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:83565141-83565163 |
| Sequence | AATGAAGTAAGGGAGGCAAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056128937_1056128943 | 23 | Left | 1056128937 | 9:83565141-83565163 | CCAGTTGCCTCCCTTACTTCATT | No data | ||
| Right | 1056128943 | 9:83565187-83565209 | CACTGATGCTATTTTTGATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056128937 | Original CRISPR | AATGAAGTAAGGGAGGCAAC TGG (reversed) | Intergenic | ||