ID: 1056128937

View in Genome Browser
Species Human (GRCh38)
Location 9:83565141-83565163
Sequence AATGAAGTAAGGGAGGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128937_1056128943 23 Left 1056128937 9:83565141-83565163 CCAGTTGCCTCCCTTACTTCATT No data
Right 1056128943 9:83565187-83565209 CACTGATGCTATTTTTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128937 Original CRISPR AATGAAGTAAGGGAGGCAAC TGG (reversed) Intergenic