ID: 1056128938

View in Genome Browser
Species Human (GRCh38)
Location 9:83565148-83565170
Sequence AGCGAATAATGAAGTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128938_1056128946 26 Left 1056128938 9:83565148-83565170 CCTCCCTTACTTCATTATTCGCT No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128938_1056128945 25 Left 1056128938 9:83565148-83565170 CCTCCCTTACTTCATTATTCGCT No data
Right 1056128945 9:83565196-83565218 TATTTTTGATCTGGAAGTAAGGG No data
1056128938_1056128943 16 Left 1056128938 9:83565148-83565170 CCTCCCTTACTTCATTATTCGCT No data
Right 1056128943 9:83565187-83565209 CACTGATGCTATTTTTGATCTGG No data
1056128938_1056128944 24 Left 1056128938 9:83565148-83565170 CCTCCCTTACTTCATTATTCGCT No data
Right 1056128944 9:83565195-83565217 CTATTTTTGATCTGGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128938 Original CRISPR AGCGAATAATGAAGTAAGGG AGG (reversed) Intergenic