ID: 1056128939

View in Genome Browser
Species Human (GRCh38)
Location 9:83565151-83565173
Sequence TTCAGCGAATAATGAAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128939_1056128946 23 Left 1056128939 9:83565151-83565173 CCCTTACTTCATTATTCGCTGAA No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128939_1056128944 21 Left 1056128939 9:83565151-83565173 CCCTTACTTCATTATTCGCTGAA No data
Right 1056128944 9:83565195-83565217 CTATTTTTGATCTGGAAGTAAGG No data
1056128939_1056128945 22 Left 1056128939 9:83565151-83565173 CCCTTACTTCATTATTCGCTGAA No data
Right 1056128945 9:83565196-83565218 TATTTTTGATCTGGAAGTAAGGG No data
1056128939_1056128943 13 Left 1056128939 9:83565151-83565173 CCCTTACTTCATTATTCGCTGAA No data
Right 1056128943 9:83565187-83565209 CACTGATGCTATTTTTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128939 Original CRISPR TTCAGCGAATAATGAAGTAA GGG (reversed) Intergenic