ID: 1056128941

View in Genome Browser
Species Human (GRCh38)
Location 9:83565179-83565201
Sequence AAAATAGCATCAGTGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128941_1056128944 -7 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128944 9:83565195-83565217 CTATTTTTGATCTGGAAGTAAGG No data
1056128941_1056128948 23 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128948 9:83565225-83565247 TCCACTGAGCCAATCACATAGGG No data
1056128941_1056128947 22 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128947 9:83565224-83565246 GTCCACTGAGCCAATCACATAGG No data
1056128941_1056128946 -5 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128941_1056128945 -6 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128945 9:83565196-83565218 TATTTTTGATCTGGAAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128941 Original CRISPR AAAATAGCATCAGTGGTCTC TGG (reversed) Intergenic