ID: 1056128946

View in Genome Browser
Species Human (GRCh38)
Location 9:83565197-83565219
Sequence ATTTTTGATCTGGAAGTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056128938_1056128946 26 Left 1056128938 9:83565148-83565170 CCTCCCTTACTTCATTATTCGCT No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128940_1056128946 22 Left 1056128940 9:83565152-83565174 CCTTACTTCATTATTCGCTGAAG No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128941_1056128946 -5 Left 1056128941 9:83565179-83565201 CCAGAGACCACTGATGCTATTTT No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data
1056128939_1056128946 23 Left 1056128939 9:83565151-83565173 CCCTTACTTCATTATTCGCTGAA No data
Right 1056128946 9:83565197-83565219 ATTTTTGATCTGGAAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056128946 Original CRISPR ATTTTTGATCTGGAAGTAAG GGG Intergenic