ID: 1056132004

View in Genome Browser
Species Human (GRCh38)
Location 9:83596475-83596497
Sequence AGGATGATTTGGCATATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056132004_1056132008 -10 Left 1056132004 9:83596475-83596497 CCAACTATATGCCAAATCATCCT No data
Right 1056132008 9:83596488-83596510 AAATCATCCTGGTAAGGTATTGG No data
1056132004_1056132009 -9 Left 1056132004 9:83596475-83596497 CCAACTATATGCCAAATCATCCT No data
Right 1056132009 9:83596489-83596511 AATCATCCTGGTAAGGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056132004 Original CRISPR AGGATGATTTGGCATATAGT TGG (reversed) Intergenic
No off target data available for this crispr