ID: 1056136174

View in Genome Browser
Species Human (GRCh38)
Location 9:83631360-83631382
Sequence ATAATCCCAGCGCCCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056136166_1056136174 26 Left 1056136166 9:83631311-83631333 CCTAAGGCTATTTAAATGTAAAT No data
Right 1056136174 9:83631360-83631382 ATAATCCCAGCGCCCCAGGAGGG No data
1056136170_1056136174 -1 Left 1056136170 9:83631338-83631360 CCAGGCTCAGTGGCTCAAGCCTA No data
Right 1056136174 9:83631360-83631382 ATAATCCCAGCGCCCCAGGAGGG No data
1056136165_1056136174 27 Left 1056136165 9:83631310-83631332 CCCTAAGGCTATTTAAATGTAAA No data
Right 1056136174 9:83631360-83631382 ATAATCCCAGCGCCCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056136174 Original CRISPR ATAATCCCAGCGCCCCAGGA GGG Intronic