ID: 1056137319

View in Genome Browser
Species Human (GRCh38)
Location 9:83642986-83643008
Sequence GGTCCTCTGCAGGATGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056137319_1056137327 6 Left 1056137319 9:83642986-83643008 CCCTGAACATCCTGCAGAGGACC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1056137327 9:83643015-83643037 TGGCTGTTTGCATGGCACAGGGG No data
1056137319_1056137325 4 Left 1056137319 9:83642986-83643008 CCCTGAACATCCTGCAGAGGACC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1056137325 9:83643013-83643035 CTTGGCTGTTTGCATGGCACAGG No data
1056137319_1056137324 -2 Left 1056137319 9:83642986-83643008 CCCTGAACATCCTGCAGAGGACC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1056137324 9:83643007-83643029 CCTGAGCTTGGCTGTTTGCATGG No data
1056137319_1056137328 14 Left 1056137319 9:83642986-83643008 CCCTGAACATCCTGCAGAGGACC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1056137328 9:83643023-83643045 TGCATGGCACAGGGGCATGCCGG No data
1056137319_1056137326 5 Left 1056137319 9:83642986-83643008 CCCTGAACATCCTGCAGAGGACC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1056137326 9:83643014-83643036 TTGGCTGTTTGCATGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056137319 Original CRISPR GGTCCTCTGCAGGATGTTCA GGG (reversed) Intronic
900630037 1:3629993-3630015 GGCCACCTGCAGGATGTGCAGGG + Exonic
900814936 1:4836543-4836565 TGACCTCAGCAGGATTTTCAGGG + Intergenic
902844046 1:19095554-19095576 GGTCCCCAGCATGACGTTCAAGG + Exonic
904786242 1:32985130-32985152 GGTCCTCTGATGGGTGTCCAGGG - Intergenic
906640605 1:47438545-47438567 GGGGCTCTGCAGGATGGCCATGG - Exonic
910220013 1:84880553-84880575 GGTCCTCTGCAGCATGGACTTGG - Intronic
914094424 1:144532641-144532663 GTTCCTCAGCAGGAAGTTCTGGG - Intergenic
914304099 1:146401247-146401269 GTTCCTCAGCAGGAAGTTCTGGG + Intergenic
914356294 1:146887300-146887322 GGACCTCTAGAGGATGTTGAGGG + Intergenic
915543137 1:156581528-156581550 GGCCCTCTGGAAGTTGTTCAAGG - Exonic
915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG + Exonic
917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG + Intronic
921955833 1:220982478-220982500 AGTCATCTGGAGGATGTGCAAGG - Intergenic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
924273702 1:242362891-242362913 GGTCCTCAGCAGGATGCTCTGGG - Intronic
1062826520 10:572953-572975 TGTCCTTTGTAGGATATTCAGGG - Intronic
1064937185 10:20691159-20691181 GACCGTCTTCAGGATGTTCAGGG - Intergenic
1066711007 10:38233763-38233785 GGCCCTCAGCAGGATGCTCTGGG + Intergenic
1067426851 10:46217177-46217199 GGGCCACTGCAGGATGTGGAGGG + Intergenic
1067528388 10:47052082-47052104 TGTCCTCTGCAGGCTGTGCTGGG + Intergenic
1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG + Intergenic
1070988838 10:80713736-80713758 CGTCCTCTGCAATAAGTTCAGGG + Intergenic
1076193322 10:128498203-128498225 TGTCCTCTGCCGGCTGTCCAAGG + Intergenic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077674224 11:4182963-4182985 GGTCCTCTGGAGAATATTAAAGG - Intergenic
1077799675 11:5525278-5525300 GGGCCCCTGCAGGATGTTTCAGG - Intronic
1078150056 11:8750778-8750800 GGTCATCTGGAAGATGTTCAAGG - Intronic
1081678083 11:44982668-44982690 GGTCTTCTGAAGGGGGTTCAGGG - Intergenic
1082992841 11:59223208-59223230 GGTCCTGTGTACAATGTTCAAGG - Intergenic
1083678181 11:64339620-64339642 TGACCTCGGCAGGATGATCAGGG - Intergenic
1089177853 11:116561234-116561256 GGTCCTATGCAGTGTGTGCACGG + Intergenic
1089964299 11:122643108-122643130 GTTCTTCTTCAGGATGCTCACGG - Intergenic
1090980647 11:131718644-131718666 AGTCCTCTGCTGGATGCTCAAGG + Intronic
1091091513 11:132775703-132775725 GAGCCTCTGCAGGATGCCCAGGG - Intronic
1091312331 11:134583566-134583588 GGTAGCCTGCAGGAAGTTCAAGG + Intergenic
1091961952 12:4703184-4703206 GGTTCTCTGCTGAATGTTTATGG - Intronic
1092523578 12:9295929-9295951 GGTGCGCTGGAGGAAGTTCAGGG - Intergenic
1092543718 12:9435970-9435992 GGTGCGCTGGAGGAAGTTCAGGG + Intergenic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1094488029 12:30940352-30940374 GGTACTCTGTTGGGTGTTCAGGG + Intronic
1094509225 12:31086081-31086103 GGTGCGCTGGAGGAAGTTCAGGG - Intronic
1096836145 12:54352494-54352516 CTTCCTCTGCAGGATTTTTAAGG + Intergenic
1104505825 12:129331268-129331290 GGTCTTCCCCAGGATCTTCAGGG + Intronic
1106663491 13:31826955-31826977 GGTCCATTGCCTGATGTTCATGG - Intergenic
1110412152 13:75216081-75216103 ATTCCTCTCCAGGATGTTCAGGG + Intergenic
1110850828 13:80242461-80242483 GATCCACTGGAGGATCTTCAGGG - Intergenic
1114535135 14:23417827-23417849 GATCCTCTGCCTGATGTTCTCGG - Intronic
1117202062 14:53400963-53400985 GGTCCTATTCAGCATGTTAAGGG + Intergenic
1119438733 14:74613880-74613902 GTTCCTCTCCAGGATGTTAGAGG + Intergenic
1121074786 14:91059700-91059722 GGACCTCTGAAGGAAATTCAAGG + Intronic
1126309623 15:47300902-47300924 AGTCCTCTGCAGGTGGTTTAGGG - Intronic
1127311314 15:57754442-57754464 GGTCCTCTGCTGGTTTTTCCAGG + Intronic
1127563163 15:60160760-60160782 TGTCCTGTGCAGAAAGTTCAAGG - Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1138426373 16:56935225-56935247 GGTCCTCTGGACGCTGATCATGG - Exonic
1139366688 16:66437953-66437975 GTTCCTCTGAGGGATGTTAATGG + Intronic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1139427178 16:66888977-66888999 GGTGCTCCCCAGAATGTTCATGG - Exonic
1139927230 16:70496332-70496354 GCTGCTGTGCATGATGTTCACGG + Exonic
1139977722 16:70828163-70828185 GGACCTCTAGAGGATGTTGAGGG - Intronic
1142502388 17:340238-340260 GGTCCTCAGCTGGGAGTTCATGG + Intronic
1143163294 17:4885210-4885232 GGTGCTCTGCAGGTTGCTCTGGG + Intronic
1144100334 17:11937263-11937285 TGTCCTCTGCAGGGAGTCCATGG - Intronic
1146273348 17:31498595-31498617 GGTGCTCTGCTGGCTGTTCAAGG + Intronic
1148129167 17:45252803-45252825 GTACCACTGCAGGATGTCCATGG + Intergenic
1153030800 18:711590-711612 GGTTCTGTGCAGGGTTTTCAGGG - Intronic
1153908330 18:9684006-9684028 GGTCCTCTGATGAATATTCAAGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156347178 18:36268242-36268264 GTCCTTCTGCAGGAAGTTCAGGG + Intronic
1158201403 18:54945799-54945821 GGTCCTCTGAAGTATCTTCCGGG + Intronic
1160912604 19:1481839-1481861 CGTCCTCTGCGGCATGTCCATGG - Exonic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1161443111 19:4303792-4303814 GGTCCCGTGGAGGAGGTTCATGG + Intergenic
1162713453 19:12613256-12613278 GGCCTTCTGCTGGATGTTTAAGG + Intronic
1166560395 19:43729041-43729063 AGTCCTCTGCTGGATGTAAAGGG + Exonic
1168149344 19:54436404-54436426 GGTCCTGTGCAGGCTGTCCATGG - Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925876699 2:8317378-8317400 GCTCCTCTACAGGATGCCCAGGG - Intergenic
928610651 2:32988716-32988738 GGACCTCTGCAGCATGTGGAAGG - Intronic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
933675043 2:85047837-85047859 GGTGTTCTGCAGGGTGCTCATGG - Intronic
936962186 2:118088094-118088116 GGTCCTCTGCGGGAAGTACCCGG + Intergenic
939724636 2:145701500-145701522 GGTTCAATGCAGCATGTTCATGG - Intergenic
940130580 2:150376891-150376913 GGTCATCTCCAGGAAGTACATGG + Intergenic
941643834 2:168018683-168018705 GCTCCTCAGGAGGATGTTCAGGG - Intronic
942746435 2:179239371-179239393 AGTCATCTGCAGGAAGTACAAGG + Intronic
945907834 2:215614822-215614844 GGTCCTCTGCTGGAGCTTCTAGG - Intergenic
947807602 2:232979237-232979259 GGTCCTTAGAGGGATGTTCATGG + Intronic
1169957343 20:11119268-11119290 AGTCCTCTGCAGATTCTTCAAGG - Intergenic
1170224931 20:13981965-13981987 GCTCCTCTGCAACATGTCCAGGG + Intronic
1172606370 20:36216876-36216898 GGTCGTTGGTAGGATGTTCAGGG + Intronic
1174765625 20:53251196-53251218 GGTAGTCAGCAGGATGTTCCAGG - Intronic
1177383435 21:20376026-20376048 GCTCCATTGCAAGATGTTCATGG - Intergenic
1180032031 21:45218503-45218525 AGTGCTCCGCAGGATATTCAAGG + Intronic
1180207073 21:46267471-46267493 GGTCCTCTGCAGCACCTTCCTGG - Intronic
1183470086 22:38000570-38000592 GTTCCTCTGCAGTCTGTGCAGGG + Intronic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
950143645 3:10632726-10632748 GGTCCTCTGCAGGTGGCTCTGGG + Intronic
951829471 3:26909096-26909118 GTTCCTATGTAGGATGTTCTGGG + Intergenic
954193384 3:48980667-48980689 AGTCCTCTGATGGATGTCCAGGG + Intronic
954292682 3:49658081-49658103 GGACCGCTGCAGGGTCTTCATGG - Exonic
955202247 3:56861692-56861714 GGCCCTCAGGAGGCTGTTCAGGG + Intronic
955737368 3:62053711-62053733 GGACCTTTGCAGGATCTTCAGGG + Intronic
961352612 3:126313603-126313625 GACCCTCTGCAGGAAGTCCAGGG - Intergenic
961558240 3:127711287-127711309 GGTCCTCTGGGGGAGGGTCAAGG - Intronic
963368113 3:144364338-144364360 GTCACTCTGCAGGATGTTTAGGG + Intergenic
964660916 3:159119375-159119397 GGTAGTCTGCCGCATGTTCAGGG - Intronic
968685039 4:1952306-1952328 TGTCCTCTGCAGGCAGCTCAGGG - Intronic
970102296 4:12538389-12538411 GGTCGCCTGCGGGATGCTCAGGG + Intergenic
976492001 4:85681722-85681744 GATCCTCTACAGGATCTTCATGG + Intronic
985083301 4:186288327-186288349 GGTTCTCTGCAGTATATTAAGGG + Intronic
989098824 5:37806046-37806068 GTTTCTCTGCAGAATGTTCTCGG - Intergenic
998388420 5:141771867-141771889 GGGCTTCTGCAGGATGATCCAGG - Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002714473 5:181217846-181217868 GTTCCTCTGCAGGAAGCCCAGGG + Intergenic
1003517650 6:6831058-6831080 GGCCCTCTGCAGGAGTTTCCAGG - Intergenic
1003734526 6:8863685-8863707 GGTCCTCTGCAGGTTGTCCAAGG - Intergenic
1004169173 6:13282560-13282582 GGCCCTCTGCAAGAAGTTCAAGG - Intronic
1004677510 6:17857825-17857847 GACCCTGTGAAGGATGTTCATGG + Intronic
1005465877 6:26112738-26112760 GGTCATCTGCAGCATGTCTAGGG - Intergenic
1006513378 6:34533344-34533366 GGTCCTCTGCAAGTTGCTGAGGG - Exonic
1006987334 6:38184651-38184673 GGTCCTCTGGAGGATGCTGCCGG + Intronic
1007192586 6:40032182-40032204 GGTTATCTGCAGTATATTCATGG + Intergenic
1008658744 6:53643992-53644014 TGACCTCTGCAGGAAGATCAGGG - Intergenic
1008682293 6:53885691-53885713 GGGCCTCCTCAGGATGGTCAGGG + Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1015882369 6:137881790-137881812 GGCCCTCTGCAAGAAGCTCAAGG + Exonic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1018788681 6:167129419-167129441 GGTTCTCAGCAGGGTGTTGAGGG - Intronic
1019588951 7:1819518-1819540 GGACCTCTGCAGCATGTCCGTGG + Intronic
1020528760 7:9301195-9301217 GGTCCTCTGTTGGTTGTTGAGGG + Intergenic
1021853903 7:24834555-24834577 GAGCCTCTGCAGCGTGTTCAGGG + Exonic
1022219836 7:28302660-28302682 GCTCCTGAGCAGGACGTTCATGG - Intronic
1022242805 7:28529330-28529352 GGTCCTCTGCAGGGAGCACAGGG - Intronic
1024154374 7:46605341-46605363 TGTCATCAGCAGGATCTTCATGG + Intergenic
1029443499 7:100600832-100600854 AGCCCTCTGCAGCATGTCCAGGG - Exonic
1032218689 7:129977724-129977746 GGACAGCTGTAGGATGTTCAGGG + Intergenic
1035575034 8:698933-698955 GTTCCCCTGCAGGATGATCCTGG - Intronic
1037305359 8:17497750-17497772 GGTCCCCTGCAGAATGTGAAGGG - Intronic
1037862735 8:22417360-22417382 GGTCCTGAACAGGAAGTTCAAGG + Intronic
1038478248 8:27884053-27884075 GTTCCTCTGCAGAATTTTCTGGG - Intronic
1042201688 8:66284990-66285012 TGTCTTCTGGAGGATGTTGAGGG - Intergenic
1043856057 8:85266160-85266182 GGGGCTGTGAAGGATGTTCAAGG + Intronic
1046934336 8:119872249-119872271 GGTCTGCTCCCGGATGTTCAAGG + Intergenic
1048448318 8:134509706-134509728 GATCTGCTGCAGGATGTTCACGG + Exonic
1049221772 8:141431801-141431823 TGTCCTCTGCAGGATGGGCTGGG + Exonic
1049305097 8:141898541-141898563 AGGCCTCTGCAGGAAATTCAAGG + Intergenic
1049492704 8:142913667-142913689 GGTCCCCTGCAGCCTCTTCAGGG + Intronic
1050525936 9:6546515-6546537 TGTCCTCTGGAAGGTGTTCAGGG + Intronic
1053118031 9:35522582-35522604 GGAGCTATGCTGGATGTTCAGGG - Intronic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1058396775 9:104562817-104562839 GGTCCTTTGGAGGATGTTTCTGG + Intergenic
1061163207 9:128907787-128907809 GGTCCGCTGCAGCATGGGCACGG - Exonic
1061992265 9:134165905-134165927 GGTCTTCTCCAGAAGGTTCAGGG + Intergenic
1062675658 9:137742094-137742116 AGGCGTCTGCAGTATGTTCATGG - Intronic
1203793673 EBV:164756-164778 GGTCCTCTGCCGGCTCATCAAGG - Intergenic
1195281156 X:103334334-103334356 TGTCCTCTGCAGAATTTTTATGG - Intergenic
1195571616 X:106403336-106403358 GTTCCACAGCATGATGTTCAAGG - Intergenic
1200076086 X:153551918-153551940 GGTCCTCTGCAGGACGCCCAGGG + Intronic
1201281348 Y:12345194-12345216 GATCCACTGCATGAAGTTCATGG + Intergenic