ID: 1056143460

View in Genome Browser
Species Human (GRCh38)
Location 9:83707266-83707288
Sequence CGGGCTGATGCCGCTTTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056143460_1056143461 -10 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 67
1056143460_1056143471 29 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143460_1056143468 19 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056143460 Original CRISPR CGGGCTGATGCCGCTTTTCT CGG (reversed) Intronic
903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG + Intergenic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
914667002 1:149840498-149840520 CGGGCTGCGGACGCTTTCCTGGG - Exonic
914668765 1:149853292-149853314 CGGGCTGCGGACGCTTTCCTGGG + Exonic
917393596 1:174566906-174566928 AAGGCTGATGAAGCTTTTCTGGG - Intronic
921269298 1:213452907-213452929 CTGGCTGGTTCCGCTTTGCTTGG + Intergenic
921818978 1:219594898-219594920 AGGAATGATGCCGCTTTGCTAGG - Intergenic
923145064 1:231191982-231192004 GGAGCTGATGCAGCTTTCCTGGG + Intronic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1068778542 10:60894261-60894283 TGGTCTGGTGCAGCTTTTCTTGG - Intronic
1070695852 10:78562460-78562482 AGGACTGATGCCTCATTTCTAGG + Intergenic
1072479320 10:95795297-95795319 CAGGATGATGCTGCTGTTCTTGG + Intronic
1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG + Intergenic
1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG + Intergenic
1087209086 11:95427945-95427967 CAGGCAGATGCCACTATTCTTGG - Intergenic
1091789051 12:3260823-3260845 GGGGCTGATGCCTCTACTCTGGG - Intronic
1092431273 12:8410985-8411007 CGGTATGATTCCACTTTTCTAGG - Intergenic
1092434176 12:8433173-8433195 CGGTATGATTCCACTTTTCTAGG - Intergenic
1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG + Intronic
1113806202 13:113111005-113111027 CGGGGTGACTCCGCTTTCCTGGG + Intronic
1117618037 14:57554301-57554323 CAGACTGATGCCTCTTTTTTTGG + Intergenic
1118073777 14:62276274-62276296 GGGGCTTTTGCCGCTTCTCTGGG - Intergenic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG + Intergenic
1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG + Intronic
1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG + Intronic
1134233489 16:12447788-12447810 GGGGCTGTTCCCGCTTTTGTGGG - Intronic
1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG + Intergenic
1139542986 16:67632456-67632478 CAGGCTGACGTCCCTTTTCTGGG - Intronic
1152198265 17:78930119-78930141 CGGGAGGATGCTGCTCTTCTCGG + Intergenic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1154494672 18:14946762-14946784 AGGGCTGATACCATTTTTCTAGG - Intergenic
1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG + Intronic
1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG + Intronic
1166267857 19:41696097-41696119 AGGGCTGATGGCGCTGTCCTGGG - Intronic
1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG + Intergenic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1167758597 19:51428806-51428828 CGGGCTCATGGCCCATTTCTTGG - Intergenic
1168605679 19:57758381-57758403 CAGGCTGAGGCCCCTATTCTAGG + Intergenic
926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG + Intergenic
934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG + Intronic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937072072 2:119072186-119072208 CGGGCTGATGCAGCCTACCTTGG + Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
937603295 2:123766870-123766892 CTGGCTGAAGCAGCTTTTGTAGG + Intergenic
937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG + Intergenic
937925850 2:127166753-127166775 CAGGCAGAAGCAGCTTTTCTGGG + Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
943449961 2:188034365-188034387 GCGGCAAATGCCGCTTTTCTGGG + Intergenic
946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG + Intergenic
947033058 2:225820150-225820172 GGGGCTCTTCCCGCTTTTCTCGG + Intergenic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1173823126 20:46031187-46031209 CACACTGATGCCTCTTTTCTAGG - Intronic
1178587599 21:33883173-33883195 CTGGCTGGTGTCGCTTTTCCTGG - Intronic
1179571291 21:42280361-42280383 AGGGCTGAGGCTGCTTTGCTGGG - Intronic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1183705788 22:39474234-39474256 TGGGCAGATGCAGCTTTCCTGGG + Intronic
1185020575 22:48372392-48372414 GAGGCTGATCCCGCTGTTCTGGG - Intergenic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
960522881 3:118676266-118676288 CAGGGTGATGCCTATTTTCTAGG - Intergenic
960747696 3:120908254-120908276 CGGGCTCCGGCCGCTTCTCTGGG - Exonic
962475438 3:135751269-135751291 TGGGCTGATCCCACTTTTCCGGG - Intergenic
965908613 3:173742305-173742327 AGGGCTGATGTCGCTGTACTAGG + Intronic
967931476 3:194693510-194693532 CTGGCTGATGCCTCTGTGCTTGG - Intergenic
982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG + Intronic
982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG + Intergenic
995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG + Intronic
1005520438 6:26596623-26596645 CGGGTTGATGCCGGCTTTTTAGG - Intergenic
1008942739 6:57064742-57064764 CTGGCAGATGTGGCTTTTCTGGG + Intergenic
1009360999 6:62814291-62814313 CGGGCTGATGCTCCTATTTTAGG - Intergenic
1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG + Intergenic
1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG + Intronic
1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1059388751 9:113985559-113985581 CGGGCTGCTGCCACCTTTGTGGG - Intronic
1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG + Intronic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic