ID: 1056143461

View in Genome Browser
Species Human (GRCh38)
Location 9:83707279-83707301
Sequence CATCAGCCCGTCCCACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056143458_1056143461 6 Left 1056143458 9:83707250-83707272 CCAGAGAAGGAAGGCTCCGAGAA 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 67
1056143460_1056143461 -10 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056143461 Original CRISPR CATCAGCCCGTCCCACAAAC AGG Intronic
900386226 1:2412274-2412296 CCTGGGCCCGTCCCACAACCTGG - Intronic
902936091 1:19765863-19765885 AATCAGCCCGTCTCACACCCAGG + Intronic
907567110 1:55445578-55445600 CATAACCCAGTACCACAAACTGG - Intergenic
910183128 1:84506551-84506573 CCTCAACCCTTCCCACAAACTGG - Exonic
913721967 1:121605228-121605250 CATCAGCCTTTCCCTGAAACTGG - Intergenic
913741751 1:121852810-121852832 CATCAGCCTTTCCCTGAAACTGG - Intergenic
923523508 1:234755043-234755065 AATCAGCCAGTGCCACAAAGCGG - Intergenic
1064251934 10:13712626-13712648 TATCAGCCAGTCCCAACAACAGG - Intronic
1068757428 10:60670648-60670670 CAGCAGCCTGTGTCACAAACGGG - Intronic
1075127022 10:119708577-119708599 CATCACCAGGTGCCACAAACTGG - Intergenic
1075159182 10:120008489-120008511 CCTCAGCCAGTCCACCAAACTGG - Intergenic
1076266073 10:129110778-129110800 CTCCAGCCCATCCCACAGACCGG + Intergenic
1080922985 11:36727227-36727249 CATCACGAAGTCCCACAAACTGG + Intergenic
1092447112 12:8568052-8568074 CAGCTGCCAGTCCCACAGACTGG - Intergenic
1103267563 12:119643809-119643831 CATCAGCCAGTTACAAAAACTGG + Intergenic
1104752721 12:131250334-131250356 CATCAGCCAGGCCCACATGCTGG + Intergenic
1110702365 13:78563546-78563568 CATCAGCCCTTCCCTCCCACAGG - Intergenic
1113287862 13:108873570-108873592 CAGCAGGCCGTTCCACCAACCGG + Intronic
1118964168 14:70563954-70563976 CATCAGTCCCTCCCCCAAACTGG + Intergenic
1119423615 14:74522486-74522508 GATCAGCCCACCCCTCAAACTGG - Intronic
1120405719 14:84091320-84091342 AAGCTGCCAGTCCCACAAACAGG + Intergenic
1121750996 14:96356215-96356237 CATCAGCACCTACTACAAACAGG + Intronic
1123696479 15:22882391-22882413 CATCAGCCCGTGACCCAAACAGG - Intronic
1131098540 15:89670924-89670946 TATCTACCCTTCCCACAAACAGG - Intronic
1134414284 16:14030260-14030282 CAACAGCCCTTTGCACAAACAGG + Intergenic
1135205521 16:20480659-20480681 CATTTGCCCGTCCCATAAACTGG - Exonic
1135213386 16:20543154-20543176 CATCTGCCCGTCCCATAAACTGG + Exonic
1136239351 16:28934648-28934670 CCTCACCCCGTCCAACAAACTGG + Intronic
1136601934 16:31297933-31297955 CATCAGCCCCTCCCATAGCCAGG + Exonic
1136610723 16:31363353-31363375 CATCAGCCCCTCCCACAGCCAGG + Exonic
1136618294 16:31411496-31411518 CATCAGCCCCTCCCACAGCCAGG + Exonic
1139523137 16:67496799-67496821 CAGCAGCCCTTCCCACTAATTGG - Intergenic
1146849753 17:36211952-36211974 CATCACCCCCTCCCCAAAACAGG - Intronic
1148073543 17:44922355-44922377 CATCAGCTTGGCCCACAAAGGGG - Intergenic
1148438800 17:47701223-47701245 CACCCACCAGTCCCACAAACTGG - Intronic
1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG + Intronic
1152636396 17:81432284-81432306 CACCAGCCAGCCCCACACACAGG - Intronic
1162736290 19:12748778-12748800 CATCAGCCCCTCCCAGCAAAGGG + Intergenic
1163131103 19:15273501-15273523 CATCATCCCCTTCCACACACAGG - Intronic
1165831127 19:38730964-38730986 CATCTGCCTGACCCACAGACAGG - Exonic
926373493 2:12204091-12204113 CTTCAGCCCCTCCCACACCCAGG - Intergenic
931573870 2:63699087-63699109 CAACAGCTACTCCCACAAACAGG + Intronic
937981678 2:127619473-127619495 CATCAGCCATTCACCCAAACTGG - Intronic
940736935 2:157464027-157464049 CCTCCGCCCGCCCCACAAAATGG - Intronic
944234081 2:197425695-197425717 CAGGAGCACGTCTCACAAACTGG + Intronic
949032018 2:241801781-241801803 CCTCAGCCTGGCCCCCAAACAGG - Exonic
1182475355 22:30574041-30574063 CATCAGCCCTTCCTAGAAAGGGG - Intronic
1183312549 22:37118658-37118680 CAAGAGCTAGTCCCACAAACCGG - Intergenic
953975881 3:47381322-47381344 CCTCAGCCTGTCCCACACCCCGG + Intronic
954107421 3:48416739-48416761 CAGCAGCTCGCCCCACAACCAGG - Intronic
956924265 3:73966757-73966779 CATCAGCCAGTTCTAGAAACTGG - Intergenic
957721589 3:84008863-84008885 CACCAACCCATCCCACACACTGG + Intergenic
960753723 3:120984227-120984249 CATCAGCCTATCCCCCAAGCTGG - Intronic
970582571 4:17487019-17487041 CATTATCTCGTACCACAAACAGG + Exonic
972396158 4:38661556-38661578 CTTCAGCCCATACTACAAACAGG + Intergenic
974152954 4:58033081-58033103 CATAAGTCCAGCCCACAAACAGG - Intergenic
977654689 4:99507071-99507093 CATCAGCCCCTCCCCCAAGTTGG - Intergenic
983730553 4:170988345-170988367 CATCAGCCTGTACCAAAATCTGG - Intergenic
986288607 5:6379357-6379379 TATCAGCCCAGCCCACCAACTGG - Intergenic
989956375 5:50365834-50365856 CATCAGCCTTTCCCCCAAACTGG + Intergenic
999055351 5:148569349-148569371 CTTCTCCCCGTCCCCCAAACAGG - Intronic
1003295771 6:4826035-4826057 CCTGAGACCGTCCCACTAACAGG - Intronic
1004456741 6:15798447-15798469 CATCTGCCCTTCTGACAAACTGG - Intergenic
1007607816 6:43129194-43129216 CATCATCCCGAGCCACACACTGG - Exonic
1017235264 6:152111843-152111865 CATCAGCCCTTCCCTCCAATTGG - Intronic
1017710150 6:157160342-157160364 TATCTGCCCATCCCACAAGCTGG + Intronic
1017913856 6:158818050-158818072 CGTCCGCCCGGCCCAGAAACTGG + Intronic
1018315277 6:162550452-162550474 CATCTGCCCATCCCCCAAACGGG - Intronic
1019610702 7:1935363-1935385 CATCAGCTCGCCCCTCAATCTGG + Intronic
1022093215 7:27121768-27121790 CAGCAGCCCCTCCCCCAAACAGG + Intronic
1026470700 7:70692659-70692681 CATCACCCCCTCCCCCAAACTGG - Intronic
1036807884 8:11847691-11847713 CTACAGCCCGACCTACAAACAGG - Exonic
1038931464 8:32198205-32198227 TATCACCCTGTCCCACAGACTGG + Intronic
1041537125 8:58939264-58939286 CCTCAGCCCCCACCACAAACAGG + Intronic
1046086467 8:109443079-109443101 CTTCAGAGCGACCCACAAACAGG - Exonic
1048973095 8:139656126-139656148 CATCAGCCTGTACCCCAACCTGG - Intronic
1049571047 8:143370457-143370479 CATCAGGCTGGCCCCCAAACTGG + Intronic
1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG + Intronic
1062556196 9:137114378-137114400 CATCCGCCCTCCCCACAGACAGG - Exonic
1195744801 X:108105874-108105896 CATCAGCCCCTCTCCCAAGCTGG - Intronic