ID: 1056143468

View in Genome Browser
Species Human (GRCh38)
Location 9:83707308-83707330
Sequence CGCCACGCCACAAACCATTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056143462_1056143468 0 Left 1056143462 9:83707285-83707307 CCCGTCCCACAAACAGGCCGCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1056143460_1056143468 19 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1056143464_1056143468 -5 Left 1056143464 9:83707290-83707312 CCCACAAACAGGCCGCGCCGCCA 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1056143465_1056143468 -6 Left 1056143465 9:83707291-83707313 CCACAAACAGGCCGCGCCGCCAC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1056143463_1056143468 -1 Left 1056143463 9:83707286-83707308 CCGTCCCACAAACAGGCCGCGCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056143468 Original CRISPR CGCCACGCCACAAACCATTG CGG Intronic
920245866 1:204587041-204587063 CTCCACGTCACATGCCATTGGGG - Intergenic
1077278028 11:1726342-1726364 GGCCACCCAACAAACCACTGAGG + Intergenic
1091235201 11:134017303-134017325 AGCCAAGCCAGAAAGCATTGTGG + Intergenic
1114666627 14:24381181-24381203 CGCCACTCCCCAAAGCATCGTGG - Intergenic
1122179298 14:99943852-99943874 CGCCACCCCACAAACCTCTCTGG - Intergenic
1123003620 14:105310600-105310622 CCCAACGCAACAAACTATTGAGG - Exonic
1138532830 16:57644049-57644071 CGCCACGCCACCCACCATGGAGG + Intronic
1139637271 16:68265166-68265188 CAGCACGCCACAAAACCTTGCGG - Intronic
1158641679 18:59208746-59208768 AGCCACGGCACAAACCGTGGAGG + Intergenic
929994497 2:46816932-46816954 CGCCACCCCACAGGCCATGGGGG + Intronic
961075451 3:123977793-123977815 GTCCACTCCACAAAACATTGAGG - Intronic
961308235 3:125974723-125974745 GTCCACTCCACAAAACATTGAGG + Intronic
961800016 3:129440235-129440257 CGCCACTCCACAAGCCACTTTGG - Exonic
978319756 4:107480844-107480866 CAGCACACCACAAACCTTTGGGG + Intergenic
983494453 4:168427683-168427705 CTCCACCCCACAAAGCATTTTGG + Intronic
999274937 5:150324006-150324028 AGCCACACAACAAACCACTGGGG - Intronic
1007664195 6:43505027-43505049 CCCCACCCCACAACCCAATGGGG + Exonic
1018816700 6:167337607-167337629 CGCCATTTCACAAACCAATGTGG - Intronic
1021159845 7:17259535-17259557 CCCCACAGCACAAACCAGTGAGG - Intergenic
1040468572 8:47717367-47717389 AGCCATGCCACAAACCAGTTAGG + Intronic
1041456850 8:58070145-58070167 AGCAACGCCACCAACCAATGAGG - Intronic
1045875995 8:106981198-106981220 AGCCACTCCACAGACCCTTGTGG - Intergenic
1048714735 8:137255847-137255869 CCCAACTCCACAAACCATTAGGG - Intergenic
1049698135 8:143993639-143993661 AGCCAGGCCACTTACCATTGGGG - Intronic
1056143468 9:83707308-83707330 CGCCACGCCACAAACCATTGCGG + Intronic
1061818741 9:133210912-133210934 CCCCAGGCCACAAAGCACTGGGG - Intergenic
1062188393 9:135230733-135230755 CCCCACCCCACAAAGCATTTGGG + Intergenic
1062241650 9:135544122-135544144 CACCAGGCCACAAAGCACTGGGG + Intergenic
1199863315 X:151821347-151821369 CGCCAGCCCCCATACCATTGGGG + Intergenic
1199949665 X:152698298-152698320 CCCCACCCCACACACCATAGAGG + Intergenic
1199960009 X:152770163-152770185 CCCCACCCCACACACCATAGAGG - Intergenic