ID: 1056143471

View in Genome Browser
Species Human (GRCh38)
Location 9:83707318-83707340
Sequence CAAACCATTGCGGTGTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056143460_1056143471 29 Left 1056143460 9:83707266-83707288 CCGAGAAAAGCGGCATCAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143463_1056143471 9 Left 1056143463 9:83707286-83707308 CCGTCCCACAAACAGGCCGCGCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143466_1056143471 -7 Left 1056143466 9:83707302-83707324 CCGCGCCGCCACGCCACAAACCA 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143465_1056143471 4 Left 1056143465 9:83707291-83707313 CCACAAACAGGCCGCGCCGCCAC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143464_1056143471 5 Left 1056143464 9:83707290-83707312 CCCACAAACAGGCCGCGCCGCCA 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1056143462_1056143471 10 Left 1056143462 9:83707285-83707307 CCCGTCCCACAAACAGGCCGCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056143471 Original CRISPR CAAACCATTGCGGTGTCCCA AGG Intronic
900909484 1:5584802-5584824 CAAACCATATCAGGGTCCCACGG + Intergenic
902416687 1:16243955-16243977 CAAACCAGGGAGGTGTCACATGG - Intergenic
902765826 1:18614394-18614416 CAAACCATGGATGTGGCCCACGG + Intergenic
904419332 1:30381507-30381529 GGAACCATTGCTGTGTCCCTGGG + Intergenic
910069097 1:83189647-83189669 CAAACCATGGCTGTGACTCATGG - Intergenic
920314722 1:205069458-205069480 CAAGCCATATCGGTGTCCCTTGG + Intronic
1063541001 10:6933876-6933898 CAAACCATCTCGGAGTCCCATGG - Intergenic
1070760316 10:79020223-79020245 GAAGCCATTGTGGTGTCACAGGG - Intergenic
1075196587 10:120364774-120364796 CTAACCATCACGGTGTCCCTGGG + Intergenic
1079945521 11:26736021-26736043 CAAACCATTTCTGTTTCCTAAGG + Intergenic
1087382819 11:97428784-97428806 CATACTATTGCAGTGTCTCATGG - Intergenic
1094499848 12:31011773-31011795 CAAACCTTTGGGGTGGCACAGGG + Intergenic
1095520288 12:43055765-43055787 GGAACCATTGCTGTGTCCCCTGG - Intergenic
1116441771 14:44962370-44962392 GAAACCATTGCCGTCTCCAAAGG - Exonic
1118413746 14:65510248-65510270 TGAACCATTCTGGTGTCCCAGGG + Intronic
1119379596 14:74220031-74220053 CAAACCACTGGGCTTTCCCAAGG + Intergenic
1122285612 14:100650464-100650486 GAAACCATTGCTGTGTCTGATGG + Intergenic
1122638478 14:103142253-103142275 GAAACCATTGCTGTGTCTCCTGG + Intergenic
1122776440 14:104118964-104118986 CAAAGCATCGCTGTGTCCCTGGG + Intergenic
1130917256 15:88314875-88314897 CAAACCATATCAGTCTCCCAAGG + Intergenic
1136864720 16:33737748-33737770 CAAACATTTGCGGTGTTTCAAGG - Intergenic
1137878475 16:52020858-52020880 CAGACCATGGAGCTGTCCCAGGG - Intronic
1142078040 16:88131804-88131826 CAAAGCACAGCCGTGTCCCAGGG - Intergenic
1142124873 16:88405290-88405312 CAAACCACAGCGGTAGCCCAGGG - Intergenic
1203126215 16_KI270728v1_random:1585884-1585906 CAAACATTTGCGGTGTTTCAGGG - Intergenic
1143412817 17:6722166-6722188 CCAAACATTGGAGTGTCCCAGGG + Intergenic
1150576859 17:66438209-66438231 CAAGCAAGTGCGGGGTCCCAAGG - Intronic
1155586069 18:27366910-27366932 CCACCCATTACGGTGTCTCAAGG + Intergenic
1157412262 18:47473072-47473094 CCAACCATAGCAGTGTTCCATGG - Intergenic
1160854729 19:1211593-1211615 CACAGCCTGGCGGTGTCCCACGG + Intronic
1166069499 19:40378824-40378846 CAAACCATTGCCACATCCCAAGG + Intronic
1168580677 19:57553373-57553395 CACACCTTTGCCGTGTCCCATGG - Intronic
1168618087 19:57854683-57854705 CAAACCATTGCATATTCCCAAGG + Intronic
1168625257 19:57912965-57912987 CAAACCATTGCATATTCCCAAGG - Intronic
929930235 2:46249710-46249732 CAAAACAATGTGGTATCCCAGGG - Intergenic
935658670 2:105446882-105446904 CACACCCTTGCTGTGTGCCAGGG + Intergenic
1169766813 20:9155491-9155513 CAATCTACTGCAGTGTCCCAGGG + Intronic
949786957 3:7752306-7752328 CCAACCATTGCAGTGTGCCCAGG - Intergenic
950898523 3:16475405-16475427 AAAACCATTGCAGTGTCTCCTGG - Intronic
956556706 3:70531940-70531962 CAAACCATTGAAGTGTACCTTGG + Intergenic
956868067 3:73388676-73388698 GGAACCATTGCTGTGTCCCCTGG - Intronic
959654918 3:108792321-108792343 CAAAGCATTGCAGTGAGCCAAGG + Intergenic
962986038 3:140536885-140536907 CAAAGCAGTGTGGTGTCCCAGGG - Intronic
983099212 4:163604497-163604519 AAAGCCATGGCTGTGTCCCAAGG - Intronic
985908954 5:2864133-2864155 CAACCCAGTGCGATGGCCCAGGG + Intergenic
986739900 5:10696820-10696842 CTAAGCATTGCGCTGTGCCATGG + Intronic
991968884 5:72119302-72119324 CAAACCTTTGCTGTGTGCCCAGG + Intronic
992364108 5:76074257-76074279 CACAGCATTGTGGGGTCCCAGGG - Intergenic
992575679 5:78108608-78108630 CAAACTATTGCAGTGAACCAAGG - Intronic
995595705 5:113745661-113745683 CAAAACATTGCAGTGTCCTAAGG + Intergenic
1016690071 6:146927632-146927654 CAAACCACTGCAGTGCCCAAGGG - Intergenic
1017265013 6:152434191-152434213 CAAAACATTGCTGGGTCCAAAGG + Intronic
1023702345 7:42905071-42905093 CAAACCCTTGCTGTGTCCCTGGG + Intergenic
1024199372 7:47090507-47090529 CAAACCATGACAGTTTCCCAGGG + Intergenic
1028917748 7:96278220-96278242 CAAACCACTGCTTTGTCCCCAGG - Intronic
1032367756 7:131315925-131315947 CAATCCAGTGCTCTGTCCCAGGG - Intronic
1048591807 8:135827276-135827298 AAAACCATTGTGGGGTCTCATGG + Intergenic
1056143471 9:83707318-83707340 CAAACCATTGCGGTGTCCCAAGG + Intronic
1188642782 X:32527148-32527170 TTAACCATTGCAGGGTCCCAGGG + Intronic