ID: 1056150966

View in Genome Browser
Species Human (GRCh38)
Location 9:83787877-83787899
Sequence TTTGATTTGTAGTGCAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056150964_1056150966 7 Left 1056150964 9:83787847-83787869 CCAAAATTTCAGAAATGGCCTTC 0: 1
1: 0
2: 0
3: 20
4: 254
Right 1056150966 9:83787877-83787899 TTTGATTTGTAGTGCAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056150966 Original CRISPR TTTGATTTGTAGTGCAACTC TGG Intronic
No off target data available for this crispr