ID: 1056151422

View in Genome Browser
Species Human (GRCh38)
Location 9:83793877-83793899
Sequence GGTCAGAAGACTGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056151416_1056151422 0 Left 1056151416 9:83793854-83793876 CCTAGCTACCTGTCATGAAATCT 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG No data
1056151415_1056151422 13 Left 1056151415 9:83793841-83793863 CCATCTATTTGCTCCTAGCTACC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG No data
1056151418_1056151422 -8 Left 1056151418 9:83793862-83793884 CCTGTCATGAAATCTGGTCAGAA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056151422 Original CRISPR GGTCAGAAGACTGGGTGTGG TGG Intronic
No off target data available for this crispr