ID: 1056155049

View in Genome Browser
Species Human (GRCh38)
Location 9:83825910-83825932
Sequence TACCATGTTATGTAAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056155049_1056155055 22 Left 1056155049 9:83825910-83825932 CCCCTATCTTACATAACATGGTA 0: 1
1: 0
2: 1
3: 3
4: 132
Right 1056155055 9:83825955-83825977 AATCTTATTTTCAATTTATCAGG No data
1056155049_1056155052 -2 Left 1056155049 9:83825910-83825932 CCCCTATCTTACATAACATGGTA 0: 1
1: 0
2: 1
3: 3
4: 132
Right 1056155052 9:83825931-83825953 TACATCATTTCCCAAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056155049 Original CRISPR TACCATGTTATGTAAGATAG GGG (reversed) Intronic
906881039 1:49591122-49591144 TACCTTTTTATGTTAGATTGAGG - Intronic
909580609 1:77229436-77229458 TACCATGGTAGGCAAAATAGTGG + Intergenic
910719275 1:90267790-90267812 TACCAAGTCATGCAAGAAAGTGG + Intergenic
915071051 1:153267618-153267640 TTGCATATGATGTAAGATAGGGG + Intergenic
916654985 1:166867155-166867177 AACTATATTATGTAAGCTAGTGG + Intronic
917203288 1:172541375-172541397 TGCCATTTTATGTAAGAGACTGG + Intronic
917605849 1:176628418-176628440 TACCTTGTTATGTACTGTAGGGG + Intronic
920082312 1:203383806-203383828 GTCCATGTTCTGGAAGATAGAGG + Intergenic
921694567 1:218192956-218192978 CACAATGTTAAATAAGATAGTGG - Intergenic
923581833 1:235224702-235224724 TACAAATTTATGGAAGATAGAGG - Exonic
924410710 1:243802293-243802315 TACCATGTCATGTAGCGTAGAGG - Intronic
1064809072 10:19173991-19174013 TAACATTTTATGTGACATAGGGG + Intronic
1069416346 10:68204264-68204286 TAGCATATTATGTAAGATGAAGG + Intronic
1069700097 10:70417916-70417938 TAGCATGCTATGTAAAATAAGGG - Intronic
1070598150 10:77847186-77847208 TACCATGTTATGAAGGCTGGGGG - Intronic
1073526059 10:104183299-104183321 TACAATGTTACTTAAGGTAGGGG - Intronic
1079655682 11:22983992-22984014 TACCATCATATGTGAAATAGAGG + Intergenic
1081109328 11:39114373-39114395 TATCATGTTATGTCACATAAAGG + Intergenic
1081394448 11:42569174-42569196 TACCATACTATGCAAGATATAGG + Intergenic
1082884538 11:58068597-58068619 TCCCATTTTATGTGAGATAAAGG - Intronic
1083484275 11:62973658-62973680 TACCATGTAAGGTAACATACAGG + Intronic
1087630176 11:100640818-100640840 TAACATGTTATTTAATCTAGGGG + Intergenic
1088403450 11:109445969-109445991 TACCATGTGTGGTGAGATAGGGG + Intergenic
1093669917 12:21861599-21861621 TACCTTGTTAGGTATTATAGTGG + Intronic
1096054429 12:48639625-48639647 TACCATGAAATGTAAAGTAGTGG - Intergenic
1101090950 12:101284712-101284734 TAACAAGTTAAGTAACATAGTGG + Intronic
1102709333 12:114911799-114911821 TCCCATTTTATCTAAGAGAGAGG + Intergenic
1106260818 13:28065100-28065122 TGCTATGCTATGTAAGAAAGAGG + Intronic
1111147913 13:84208870-84208892 TTCCATGTACTGTAAGATTGAGG + Intergenic
1112428560 13:99328414-99328436 TACCATGTTATTTTACAAAGTGG + Intronic
1114885614 14:26846386-26846408 TATAATTTTATGTAAGACAGAGG + Intergenic
1120115101 14:80606813-80606835 CACCATGTTATATAATATATAGG + Intronic
1120667793 14:87327512-87327534 TACCATCTTATGAAAAACAGCGG - Intergenic
1121343646 14:93119494-93119516 TACCTTATGAAGTAAGATAGAGG - Intergenic
1128583927 15:68830674-68830696 TACCATGTTATGCAAGTTCAAGG - Intronic
1136676867 16:31918166-31918188 TTCCATCTTATCTAAGATTGTGG + Intergenic
1137018837 16:35402304-35402326 CACCATGTTCTGTCAGATACAGG - Intergenic
1142241252 16:88947461-88947483 TACCTAGTTTTGTACGATAGGGG - Intronic
1143691181 17:8567411-8567433 TTCCAAGTTATGTAAGAAATAGG - Intronic
1145843278 17:28014420-28014442 GACAATGTTTTGGAAGATAGAGG - Intergenic
1147003573 17:37383380-37383402 TACTATGTTATGAAGGAAAGAGG - Intronic
1149040284 17:52180225-52180247 GACCATATTCTGTATGATAGAGG + Intergenic
1155463310 18:26108117-26108139 TTGTATGTGATGTAAGATAGAGG + Intergenic
1156132133 18:33988876-33988898 TATCAAGTTATTTAAAATAGAGG + Intronic
1156212463 18:34960163-34960185 TTCCATTTTATGTAAAAGAGTGG - Intergenic
1157643373 18:49241557-49241579 TTCCATGTTTTGGAAGATGGTGG + Intronic
1159845973 18:73460447-73460469 AGCCAAGTTATGTAAGATAATGG - Intergenic
927316811 2:21692786-21692808 TTCCATGTTATGAAAGGTTGGGG + Intergenic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
928827069 2:35435763-35435785 CACCATGTTATATAACATAAAGG - Intergenic
929916482 2:46140992-46141014 TACCATGTTGGGAAAGATATCGG + Intronic
930644232 2:53887309-53887331 AACCATGTTATGGAAGAAAATGG - Exonic
931060841 2:58527815-58527837 TACCATGTTATTATGGATAGTGG + Intergenic
934537649 2:95149084-95149106 TCCCATGTTTGGTAAGAGAGGGG + Exonic
936497823 2:113037704-113037726 TACCATAATATGAATGATAGAGG + Intronic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
939145332 2:138407429-138407451 TACCATGTTCTGGATGCTAGAGG + Intergenic
939239830 2:139543379-139543401 TACTATTTTGTGTAAGATTGTGG - Intergenic
939654620 2:144808403-144808425 TACCATGCTATTAAAAATAGTGG + Intergenic
939822442 2:146974111-146974133 TAAAATGCTATGGAAGATAGTGG + Intergenic
1170150804 20:13223403-13223425 TACCATGTCTTGTAAGATTATGG - Intronic
1170994112 20:21335494-21335516 TGTCATTTTATGTAACATAGTGG + Intronic
1178946623 21:36953556-36953578 TACTATATTATGTAGGATACAGG - Intronic
951790300 3:26475236-26475258 TATCATGTAATGAAAGATATTGG - Intergenic
952128288 3:30329505-30329527 TACCATGTTATTTATAAAAGTGG - Intergenic
956122030 3:65976172-65976194 TATCATCTTATGTCACATAGGGG - Intronic
957146390 3:76429841-76429863 TGTCAGGTTATGTAGGATAGAGG + Intronic
957483342 3:80827222-80827244 TACCATGGAATACAAGATAGAGG - Intergenic
958625377 3:96615990-96616012 TAACATGTTCTTTAAGATGGGGG + Intergenic
959756256 3:109903272-109903294 TAACATGTTTTGACAGATAGGGG + Intergenic
960879555 3:122330971-122330993 TAACATATTATATAAGATAATGG - Intronic
963530488 3:146469027-146469049 TACCAGCTTAGGAAAGATAGTGG - Intronic
963537176 3:146543925-146543947 TACCAGCTTAGGAAAGATAGTGG - Intronic
965201601 3:165665577-165665599 TTGCATTTTATTTAAGATAGAGG + Intergenic
967386978 3:188921415-188921437 TAGAATGTTATGTTAGAAAGTGG - Intergenic
971535016 4:27737395-27737417 TAACATCTTATGTCAGGTAGTGG - Intergenic
973611998 4:52644713-52644735 TTCAATATCATGTAAGATAGCGG - Intronic
974572603 4:63673283-63673305 TATCTTGTTATGTAAGACAAGGG - Intergenic
975271746 4:72443249-72443271 TACCATGTAATGGAAGTTTGAGG - Intronic
975765848 4:77666893-77666915 TACAATGTTAAGTAAGACAGAGG + Intergenic
976346308 4:84005897-84005919 TACAATCTTATGTTAGATAAAGG - Intergenic
976488439 4:85638109-85638131 CACCATGATAGGTAAGATGGAGG - Intronic
978177011 4:105744093-105744115 GACCATGTTATGAAAGACAAAGG - Intronic
978840140 4:113202299-113202321 TACTGTCTTATGTAAGATACAGG + Intronic
979389338 4:120109168-120109190 TATTATTTTATGTAACATAGGGG - Intergenic
979546551 4:121946565-121946587 AACCATCTTGTGGAAGATAGGGG + Intronic
981999596 4:151010075-151010097 TACCATTTTATATAAGAGACTGG + Intronic
987692601 5:21285692-21285714 CACCATGTTATGCAAGATTTAGG - Intergenic
990289396 5:54333334-54333356 TTCTATGTGATTTAAGATAGGGG - Intergenic
991978740 5:72210125-72210147 CAACATATTATGTTAGATAGAGG - Intergenic
993155240 5:84214346-84214368 TGCCATTTTATATAAGATACTGG - Intronic
994349516 5:98728470-98728492 TACCATGTTCTTTTAAATAGTGG - Intergenic
994864796 5:105253664-105253686 TAACAGTTTATGTAAGTTAGAGG + Intergenic
997364221 5:133315365-133315387 TTCGTTGTTATGTAGGATAGTGG - Intronic
998356997 5:141547099-141547121 TAACATGTTCTGGAATATAGAGG + Intronic
1003649109 6:7942093-7942115 TAACATGCTATGTAATATACAGG - Intronic
1004147786 6:13084702-13084724 TACATTGTTATGTAGGATACTGG - Intronic
1004810425 6:19254089-19254111 TATCATATTATTTCAGATAGAGG - Intergenic
1008066812 6:47058891-47058913 TACCATGTTGTGGCAGATATCGG - Intergenic
1008306991 6:49915358-49915380 TCCCAGTTTGTGTAAGATAGAGG + Intergenic
1009658626 6:66579845-66579867 TAACATGCTATATAAGAAAGTGG - Intergenic
1013129500 6:107218723-107218745 GACCAAGTTAGGAAAGATAGAGG - Intronic
1016158679 6:140847824-140847846 TACCATTTTATGTAATCTAATGG + Intergenic
1017071712 6:150580637-150580659 TGCCATGGTATGTAACATAATGG - Intergenic
1017323624 6:153121285-153121307 TAAAATGTTATGTTAGAGAGAGG - Intronic
1018920959 6:168173690-168173712 TAACTGGTTATGTAAGAAAGAGG + Intergenic
1022641980 7:32195803-32195825 TACCTTATTATGCCAGATAGAGG + Intronic
1028272207 7:88805999-88806021 TGCCACATTTTGTAAGATAGTGG + Intronic
1028310696 7:89330374-89330396 TACCATTTTGTGTGAGATAAGGG - Intronic
1028545851 7:91998865-91998887 TAGCATATTCTGTGAGATAGAGG + Intronic
1028825356 7:95266338-95266360 TATCATGTTATCTAACATATAGG + Intronic
1029461850 7:100699228-100699250 TAACAGGTCATGTAAGATAATGG - Intergenic
1030915490 7:115307048-115307070 TGCCATCTTATGTAATATAAGGG + Intergenic
1037553115 8:19994070-19994092 TTCCGTGTTATGTAAGATGATGG + Intergenic
1042031913 8:64485569-64485591 TACCATTTTATATAAGAGACTGG + Intergenic
1043476748 8:80612554-80612576 CACCATTTTATGAAAGATAGAGG + Intergenic
1044370565 8:91405494-91405516 TACGATGTTATGAAAAAGAGTGG - Intergenic
1044813569 8:96088221-96088243 TACCATGATTGATAAGATAGAGG - Intergenic
1045446124 8:102266180-102266202 TCCCATGTTCTGCAAGATAATGG - Intronic
1045611693 8:103850084-103850106 TACCTTGTTAAATAAGATACTGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1051980037 9:23002741-23002763 TACCCTGTTGTGTAAAAAAGGGG + Intergenic
1056028173 9:82523205-82523227 TACTATGTTATTCAAAATAGGGG + Intergenic
1056155049 9:83825910-83825932 TACCATGTTATGTAAGATAGGGG - Intronic
1056883886 9:90421242-90421264 TACCATGCTCTGTAAGAGACAGG + Intergenic
1058439776 9:104996008-104996030 TAACATGATATGTAAAAAAGAGG + Intergenic
1187668735 X:21646558-21646580 TACAATGTTAGGTAATATGGAGG + Intronic
1188713512 X:33431844-33431866 TAGCATGATATTTAAAATAGGGG + Intergenic
1189295843 X:39917005-39917027 TACCAAGTTAGGTAAGATCTAGG - Intergenic
1192351796 X:70362023-70362045 GGCCATGTTTTGTAAAATAGTGG + Intronic
1194178832 X:90688346-90688368 TACCAGGTTCTGGAAGATGGTGG + Intergenic
1194640049 X:96392882-96392904 TATCCTGTTTTGTAAAATAGAGG + Intergenic
1194765055 X:97839976-97839998 AACCATCTTATGTTAGATACTGG + Intergenic
1195600062 X:106736397-106736419 AATCATGTTATGAAAGACAGAGG - Intronic
1196505706 X:116438765-116438787 TACCCAGTTATGAAATATAGGGG - Intronic
1198580278 X:138056255-138056277 TACAATATTATGTGAGAAAGTGG + Intergenic
1200525497 Y:4270516-4270538 TACCAGGTTCTGGAAGATGGTGG + Intergenic