ID: 1056162038

View in Genome Browser
Species Human (GRCh38)
Location 9:83906387-83906409
Sequence CTGGAGAACCTGCCAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 6, 3: 27, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056162038_1056162046 6 Left 1056162038 9:83906387-83906409 CCCTCCTCTGGCAGGTTCTCCAG 0: 1
1: 1
2: 6
3: 27
4: 336
Right 1056162046 9:83906416-83906438 TCCACTAAATATGGTTTTTAGGG No data
1056162038_1056162049 28 Left 1056162038 9:83906387-83906409 CCCTCCTCTGGCAGGTTCTCCAG 0: 1
1: 1
2: 6
3: 27
4: 336
Right 1056162049 9:83906438-83906460 GGAAGAAGACATCCAAGAATAGG No data
1056162038_1056162045 5 Left 1056162038 9:83906387-83906409 CCCTCCTCTGGCAGGTTCTCCAG 0: 1
1: 1
2: 6
3: 27
4: 336
Right 1056162045 9:83906415-83906437 TTCCACTAAATATGGTTTTTAGG No data
1056162038_1056162048 7 Left 1056162038 9:83906387-83906409 CCCTCCTCTGGCAGGTTCTCCAG 0: 1
1: 1
2: 6
3: 27
4: 336
Right 1056162048 9:83906417-83906439 CCACTAAATATGGTTTTTAGGGG No data
1056162038_1056162044 -3 Left 1056162038 9:83906387-83906409 CCCTCCTCTGGCAGGTTCTCCAG 0: 1
1: 1
2: 6
3: 27
4: 336
Right 1056162044 9:83906407-83906429 CAGGAAGGTTCCACTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056162038 Original CRISPR CTGGAGAACCTGCCAGAGGA GGG (reversed) Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900361971 1:2293435-2293457 CAGGAGAACCTTCCAGATGTTGG - Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
901018136 1:6243132-6243154 CTGGAGCACTTGCCCCAGGATGG - Intergenic
901069169 1:6508715-6508737 GTGGAGAGCCTGCCTGAGGCTGG - Intronic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
901651617 1:10746465-10746487 TAGGAGAAGCTCCCAGAGGAAGG + Intronic
901972034 1:12915667-12915689 CTGGGGCAGATGCCAGAGGAAGG - Intronic
902013145 1:13286095-13286117 CTGGGGCAGATGCCAGAGGAAGG + Intergenic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
903064956 1:20694336-20694358 CCTCAGATCCTGCCAGAGGAGGG + Intronic
903144381 1:21361325-21361347 GTGGAGAAGCTGCCAGAACATGG + Intergenic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904200893 1:28818433-28818455 CTCCAGACCCAGCCAGAGGAGGG + Intronic
904592970 1:31625495-31625517 CTGGAGCCCCTGCCCGAGGAAGG + Intronic
904656602 1:32053241-32053263 CTGGAGGAGCTGCCTGAGAAAGG + Intronic
905044114 1:34983048-34983070 CTGGAGAACCTTGAACAGGAAGG - Intronic
905803023 1:40857801-40857823 CTGGAGGAGCTGCCAGGGTACGG - Intergenic
905823905 1:41015181-41015203 CAGGAGAAACGGCCAGAGGCAGG + Intergenic
906107684 1:43304696-43304718 CTGAAGAACCGGGCAGGGGAAGG + Intronic
906246121 1:44275531-44275553 CAGGAGAAACTGCCAAAGGGAGG - Intronic
907015272 1:51006002-51006024 CTGACGAAGCTTCCAGAGGAAGG + Intergenic
907709045 1:56860863-56860885 TTGGAGAACTGGCCAGAGGCAGG + Intronic
907824123 1:57999214-57999236 CTGTAGAACAAGCCAGAGAAGGG + Intronic
909276221 1:73690278-73690300 TGGGAGAAACTTCCAGAGGAAGG - Intergenic
909331678 1:74420367-74420389 CTAGAAAGACTGCCAGAGGAAGG + Intronic
909465027 1:75963951-75963973 CTGCAGAAGCAGCCAGATGAAGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
911148994 1:94579498-94579520 ATGGAGGACCTTCCAGAGGAAGG - Intergenic
911763227 1:101640683-101640705 TTGGAGAACATACCTGAGGATGG + Intergenic
912232981 1:107817237-107817259 CTGGGGAACCTCGCAGAGAAGGG + Intronic
912551704 1:110489348-110489370 CTGCAGATCCTGGCAGGGGAGGG + Intergenic
913323961 1:117610203-117610225 CTGTAGAACTAGCCAGAGGCAGG - Intronic
915061910 1:153193149-153193171 CTGGATAAACTGCCACAGGATGG + Intergenic
915832674 1:159145780-159145802 CTGGAGAATCTGTCAGAGGTGGG - Intronic
917371539 1:174298813-174298835 CTGCAAATCCTGCCAGATGATGG - Intronic
917406046 1:174709455-174709477 CTGATGAAGCTTCCAGAGGAAGG + Intronic
918848926 1:189657855-189657877 CTGGAAAACCTACCTGATGACGG - Intergenic
919619755 1:199851397-199851419 CTGGAAAATCTGCTAAAGGAAGG - Intergenic
920102428 1:203525727-203525749 CTGGAGAACCTGCCAGTGGCAGG - Intergenic
920299796 1:204981754-204981776 CTGGAGAGGCTGCCAGAGAGGGG - Intronic
921380131 1:214516110-214516132 CTTGAGAACCTGGCAGTGGCAGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922367480 1:224879327-224879349 CTGATGAACCTCACAGAGGAAGG - Intergenic
922473857 1:225892561-225892583 GTGGAAAACCTGCCAGTGGCTGG - Intronic
922860209 1:228810118-228810140 CTGGAAAAACTCCAAGAGGATGG - Intergenic
922870790 1:228900356-228900378 CAGGAGAGCTGGCCAGAGGATGG - Intergenic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923128179 1:231050653-231050675 CTGAAGGACCTGCCTGAGGCTGG + Intergenic
923192336 1:231631410-231631432 CTGAAGGACCTGCCTGAGGCGGG - Intronic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924193110 1:241577175-241577197 CTCAAGAACATGCCAGAGAAAGG - Intronic
924432664 1:244010007-244010029 CTGGAGAAACTTCAAAAGGAAGG - Intergenic
1065286319 10:24190725-24190747 CTGGAGTAGGTGCCAAAGGATGG - Intronic
1065818162 10:29500582-29500604 CTGGGGAACCTCCTAGAAGAAGG - Intronic
1065954757 10:30683920-30683942 CTGGGGGACCTGCTAGAAGAAGG + Intergenic
1067701962 10:48580283-48580305 CTGGAAAACGTGGCAGGGGAGGG + Intronic
1068231743 10:54176642-54176664 CTGGAAAACCTACCAATGGAAGG - Intronic
1068795325 10:61072997-61073019 CTCGAGGACCTGCCTGAGGCTGG + Intergenic
1069528407 10:69195221-69195243 TTAGAGATCCAGCCAGAGGATGG + Exonic
1069707747 10:70469282-70469304 CTGGAGATTCTGGCTGAGGAGGG + Intergenic
1071432807 10:85619514-85619536 TGGGAGAACTTCCCAGAGGAGGG - Intronic
1072695309 10:97599075-97599097 CTTGAGTGGCTGCCAGAGGAAGG - Exonic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073436922 10:103522822-103522844 CTGGAGAGCGTGCCTTAGGAGGG - Intronic
1074820483 10:117174686-117174708 CTGTAAAGCCTGGCAGAGGAGGG + Intergenic
1075139246 10:119816730-119816752 CTGGAGAGCCAGGCAGCGGAAGG + Intronic
1075661976 10:124203930-124203952 CTGCAGAACCTTCAGGAGGATGG + Intergenic
1075808542 10:125207696-125207718 CTGGAGGGCCTGGCAGTGGAGGG + Intergenic
1075918445 10:126189835-126189857 CTGCAGAACCTTCCTGAAGACGG + Intronic
1076056127 10:127374675-127374697 CTGGATTACCTGCAAGGGGAGGG + Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1076699175 10:132261224-132261246 CTGGAGAATCTCCCCGGGGAAGG + Intronic
1077071173 11:674067-674089 CTGAAGAACGTGCCAGAAGCTGG + Intronic
1077967703 11:7153343-7153365 CTGGCAGAGCTGCCAGAGGAAGG - Intergenic
1078331775 11:10428432-10428454 ATGGATACCCTGTCAGAGGAAGG + Intronic
1078854943 11:15199601-15199623 CTCAAAAACCTGACAGAGGATGG + Intronic
1081771489 11:45652855-45652877 CTGGGGAACCTACCAGATGGGGG - Intronic
1082261118 11:50076851-50076873 CTGGAGAGCCTGTCAAAGGCAGG + Intergenic
1082786874 11:57322200-57322222 TTGGAGAGCTTGTCAGAGGAGGG - Intronic
1083321113 11:61847502-61847524 CTGGAGAACATGCTAAGGGAAGG - Intronic
1083720541 11:64601556-64601578 CTGGGGAACCTGCGATGGGACGG + Exonic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1083998737 11:66284712-66284734 CTGGAGACGCTGCCGGGGGACGG + Exonic
1084509938 11:69597186-69597208 ATGGAGTACCTGCCATGGGAGGG + Intergenic
1088888829 11:114029131-114029153 CTGGAAAGGCTGCCAGAGGGGGG + Intergenic
1089728493 11:120504151-120504173 CTGCACCTCCTGCCAGAGGAAGG - Intergenic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091278946 11:134371035-134371057 ATGGAGAACCTGCCAGTCAATGG + Exonic
1096604008 12:52752168-52752190 CTGGATAACATGCCAGTGGGTGG + Intergenic
1097180351 12:57168283-57168305 CTGGAGAACCTGCAGGGGGCTGG - Intronic
1100164489 12:91901064-91901086 CTTGAGAAGCTGTGAGAGGAGGG + Intergenic
1100358591 12:93855295-93855317 CTGGAGAACTCCCCAGAGAAAGG - Intronic
1101563366 12:105881426-105881448 CTGCAGAACCTACAAGAAGAAGG - Intergenic
1103931240 12:124452181-124452203 CTGCAGAACTTCCCAGTGGAGGG + Intronic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1106172339 13:27298676-27298698 CTGGAGAGACTACCACAGGAAGG - Intergenic
1106411576 13:29514742-29514764 CTGGAGCAGCTGCCACACGAAGG + Intronic
1109515986 13:63443011-63443033 CTGGAGAACATGCATGAGAATGG + Intergenic
1109535770 13:63717401-63717423 CTCTAGAAGCTGTCAGAGGATGG - Intergenic
1109540331 13:63768885-63768907 CTCTAGAAGCTGTCAGAGGATGG + Intergenic
1111157607 13:84349069-84349091 CTGGAGGACATGTCACAGGAAGG + Intergenic
1111882419 13:93974128-93974150 CAGGGGAACCTGCCAAAAGAAGG - Intronic
1112200121 13:97266535-97266557 CTGGAGGAGCTGCCAGCTGAAGG - Intronic
1112549400 13:100405241-100405263 CTGTAAATCCTGCCAGGGGATGG - Intronic
1113462402 13:110491365-110491387 CCGGAGGGCCTGCCTGAGGAAGG - Intronic
1113828339 13:113274240-113274262 ATGGAGGACCTGGCAGAGGGGGG - Intergenic
1114312003 14:21476636-21476658 CTGGAACACCTTCCAGAGTATGG + Intronic
1117454524 14:55884100-55884122 GAGCAGAAGCTGCCAGAGGAAGG - Intergenic
1117571343 14:57052100-57052122 CTGGAGAACCAACCAGAAGTAGG - Intergenic
1118951739 14:70441667-70441689 CTGGTCAGCCTCCCAGAGGAGGG + Intergenic
1119016509 14:71061885-71061907 CTGAAGAACAGGCCAGAGAAAGG + Intronic
1120668258 14:87333224-87333246 CTGGACCAGCTGCTAGAGGAGGG + Intergenic
1121275629 14:92665893-92665915 CCGGATCACCTGCCAGGGGAAGG - Intronic
1122477349 14:102019986-102020008 CTGGAGACCCTGCCTGTTGAAGG + Exonic
1122896179 14:104758247-104758269 CTGGAGAGCCCTGCAGAGGACGG - Intronic
1123112797 14:105880968-105880990 CTGGAGGCCCAGCCAGAGAAGGG - Intergenic
1202837362 14_GL000009v2_random:88025-88047 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202906748 14_GL000194v1_random:78155-78177 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1126090836 15:45049668-45049690 CTGCAAATCCTGCCAGATGATGG - Intronic
1127319577 15:57829802-57829824 TTGGGGAACATGCCAGAGAAGGG - Intergenic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1130511946 15:84596481-84596503 CTGGAGAGCCTTCCCAAGGATGG + Intergenic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1132511737 16:346079-346101 CTGGAGAACAAGCCAGGGAAAGG - Intronic
1133111478 16:3550489-3550511 CTGGAGAACCTGCAAGAGAAGGG + Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133306640 16:4813707-4813729 CTGGAGAGCCAGCCCAAGGAAGG + Intronic
1134264608 16:12682415-12682437 CTGTAGAATATGCAAGAGGAGGG + Intronic
1134449758 16:14356014-14356036 CGGGAAAACATGCCAGAGAAGGG + Intergenic
1136014240 16:27384882-27384904 CGGGAGAAACTGCCTCAGGATGG - Intergenic
1137569742 16:49557634-49557656 CTGGAGGAGCTGCCAGGTGATGG + Intronic
1138457370 16:57129133-57129155 CTGGAGGAACTGGCAGAGGTGGG + Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139187008 16:64818639-64818661 CTGGAGAAACTGCAAGGTGAGGG - Intergenic
1141377227 16:83542612-83542634 CTGGACTAGCTGCCAGAGCATGG - Intronic
1141763747 16:86045435-86045457 CTGCAGCACCTGCCAGCGCATGG + Intergenic
1142189282 16:88710260-88710282 CTCAAGAACCTGCCAGACCATGG - Exonic
1142683983 17:1566697-1566719 CTTGAGAAACTGAGAGAGGACGG - Intergenic
1144236106 17:13262260-13262282 ATGGGGCACCTGCCAGAGGCAGG + Intergenic
1147578730 17:41617027-41617049 CAGGACATCCTGCCAGGGGAAGG - Intergenic
1148242715 17:46010993-46011015 CTGGAGTCTCTGCCAGAGGGTGG - Intronic
1150122740 17:62617367-62617389 AGGGGGAACCTGCCAGAGGCTGG + Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151685118 17:75641763-75641785 CTTCACAAACTGCCAGAGGAAGG + Intronic
1152451469 17:80383903-80383925 CTGCAGGAAATGCCAGAGGATGG - Exonic
1152794079 17:82298407-82298429 CTGGGCAACCTTCCTGAGGACGG + Intergenic
1152895380 17:82907889-82907911 CTGCAGACCCTGCCTGGGGAGGG - Intronic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1155530307 18:26759928-26759950 TTGGAGAATCTGGTAGAGGAAGG + Intergenic
1155540374 18:26863360-26863382 CTGGAGCACCTCTCAGAGGGCGG + Intronic
1155784668 18:29881193-29881215 CTGCAAATCCTGCCAGAAGATGG - Intergenic
1156698603 18:39796785-39796807 CTGCAGATCCTGCCAGGTGATGG - Intergenic
1156700533 18:39819317-39819339 CTGCAAAAACTGCCAGAGTAAGG - Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1160343922 18:78113757-78113779 CTGGAGGATCTGGCAGGGGAGGG + Intergenic
1160699047 19:497504-497526 TTGGTGATCCTGCCAGAGGAGGG + Intronic
1161361001 19:3849665-3849687 CTGGGGATCCTTCCAGAGTATGG - Intronic
1161803237 19:6427242-6427264 CTGGAGCATCTGCAAGAGAAGGG + Exonic
1162100129 19:8334284-8334306 CGGCAGAAGCTGCCACAGGAGGG + Intronic
1163289427 19:16369878-16369900 CTGGAAATCCCCCCAGAGGATGG - Intronic
1163749199 19:19065197-19065219 GTGGAGACGCTGCCGGAGGAGGG + Intronic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1164820804 19:31249759-31249781 ATGAAGGACCTGCCAGAGGGAGG - Intergenic
1166403105 19:42498596-42498618 CTGGAACACTTGCCAGGGGAGGG + Intergenic
1166751696 19:45166905-45166927 CTGGAGAGCGTGTCCGAGGAAGG + Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167145193 19:47677184-47677206 CTCGAGCACCTGCCAGGGGCCGG + Intronic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
1202649937 1_KI270706v1_random:170775-170797 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
925261221 2:2530193-2530215 CTGTGGCACCTGCCAGAGGGAGG - Intergenic
925352273 2:3209651-3209673 ATGGAGAACCTTCCAGACAATGG + Intronic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925920251 2:8633240-8633262 CTGCCCCACCTGCCAGAGGAAGG + Intergenic
926000937 2:9331915-9331937 CTGCAGAAGCTTGCAGAGGAGGG + Intronic
926358404 2:12062550-12062572 CAGGGGAACCTGGCAGAGGCAGG - Intergenic
927473863 2:23397209-23397231 CTGGAGCCCCTGCCACAGGAGGG - Intronic
928132799 2:28665311-28665333 TGGCAGAATCTGCCAGAGGAAGG - Intergenic
928398327 2:30960172-30960194 CTGCAGCCTCTGCCAGAGGATGG + Intronic
929578997 2:43070044-43070066 CTGGAGAAGCTGGGAGAAGAGGG - Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
935714055 2:105924480-105924502 CTGCAGAGCCTGCCACAGGACGG + Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936578501 2:113675102-113675124 CTGGAGAGCCTGCCAGATGTAGG - Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
942548270 2:177087988-177088010 CTGAAGAATCTCCCAGATGAAGG - Intergenic
944595548 2:201257601-201257623 CTGGAGAACATGGCCAAGGATGG + Intronic
946176031 2:217922460-217922482 CAGGCCAAGCTGCCAGAGGACGG + Intronic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
948523890 2:238558730-238558752 CTGGAGGACCGGCCATGGGAGGG - Intergenic
948580983 2:238986952-238986974 CAGGTGACGCTGCCAGAGGAAGG - Intergenic
1168991763 20:2102112-2102134 CTGGAGCCCCTGCCTGGGGATGG - Exonic
1169396964 20:5241102-5241124 GGGAAGAAGCTGCCAGAGGAAGG - Intergenic
1170142619 20:13140115-13140137 CTGGAAGTCATGCCAGAGGAGGG + Intronic
1170947481 20:20904302-20904324 CTGGACAAACTCCCTGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171881431 20:30620508-30620530 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1171983054 20:31640441-31640463 TTGGTGGACCTCCCAGAGGAGGG + Intronic
1172121258 20:32600185-32600207 CTGGAGAAAATGTCAGAGAAGGG + Intronic
1172283717 20:33726191-33726213 CTGGGGAGCCTGCCAGAGGTGGG + Intergenic
1172586003 20:36085377-36085399 CTTGTGTACCTTCCAGAGGAAGG - Intergenic
1172758048 20:37301315-37301337 CTGGAGAACCTGCTACGGTACGG + Exonic
1173120743 20:40287048-40287070 CTTGAGAAGCTGCCAAAGGGTGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1174078349 20:47953821-47953843 CAGGAGAACCTGCCAATTGATGG - Intergenic
1175742511 20:61429890-61429912 CTGCAGATCCAGCCAGAGGAAGG - Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176601885 21:8801772-8801794 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1176626098 21:9092954-9092976 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1178574804 21:33776436-33776458 CTGTAGTACCTGCCTGAGGCAGG + Intronic
1179087145 21:38227965-38227987 CTGGTCAGCCTCCCAGAGGAGGG + Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180085296 21:45505467-45505489 CTGCAGAACCAGCCAGGGCACGG - Intronic
1180344170 22:11693323-11693345 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1180365423 22:11933901-11933923 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1181054440 22:20253490-20253512 CTGGAGAAACACCCAGAGAAAGG + Intronic
1181161540 22:20962855-20962877 CAGGAGAACCTGACAGTAGAGGG + Intergenic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1182277824 22:29201578-29201600 TAGGAGAAATTGCCAGAGGAGGG + Intergenic
1182859986 22:33551261-33551283 CTGGAGAATCTGCCTTAGTACGG - Intronic
1183025911 22:35065927-35065949 CTGGGGAACTGGCCAGAGCAGGG - Intergenic
1183573433 22:38671458-38671480 CGGGAGAGCTTCCCAGAGGAAGG + Intronic
1184012915 22:41762838-41762860 GTGGAGCAGCTGCCAGAGCAGGG + Intronic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1184296366 22:43527774-43527796 TTGGAGAACCTTCCAGAAGGTGG + Intergenic
1184770553 22:46594471-46594493 CGGGAGCACTGGCCAGAGGAGGG + Intronic
949226399 3:1700270-1700292 CGTGACAACCTGCCTGAGGAAGG + Intergenic
949915157 3:8955666-8955688 CTGGAGAACCTGCAATACCATGG + Intronic
950163496 3:10776947-10776969 CAGGAGAAACTGGCAGGGGAGGG - Intergenic
950472729 3:13196574-13196596 CTGGAGAACAGGCCACAGGGAGG + Intergenic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
953289875 3:41650035-41650057 CGGGACAACCTGCCTGTGGAAGG + Intronic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955604995 3:60692087-60692109 GTGGAAAACCTGCTAGAGGATGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955948332 3:64217014-64217036 CTGGATAAGCTGTCAGGGGAAGG + Intronic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
959272000 3:104223597-104223619 CTGAAGAACCTGCCTGAAGCTGG - Intergenic
959652461 3:108764178-108764200 CCGCAGAAACTGCTAGAGGAGGG + Intergenic
960039543 3:113136019-113136041 CAGGAGGCCCTGCCAGAGGAAGG + Intergenic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961984989 3:131122627-131122649 CCTGAGAACCTGCTAGATGAAGG + Intronic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
962329673 3:134466537-134466559 CTGCAGAACATGCCAAAGCATGG + Intergenic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
963084621 3:141425529-141425551 CTGCAGTGCCTGCCAGAAGAAGG - Intronic
964748401 3:160032858-160032880 CTGGAGAACCTGCTGGAAAACGG - Intergenic
964904922 3:161707856-161707878 GGGGAGAAGCTTCCAGAGGAAGG + Intergenic
966561369 3:181324597-181324619 GGGGAGAAGCTTCCAGAGGAAGG - Intergenic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
967497552 3:190158821-190158843 CTGTTGAACCTGCCAAAGGGCGG + Intergenic
968007646 3:195254171-195254193 CTGGAGAACCTGCCAGGCCTGGG - Intronic
968681049 4:1920121-1920143 CTGGAAATTCTGCCAGAGAAAGG + Intronic
971375898 4:26055685-26055707 CTGGAAAAGCTCCCAGAGCAAGG - Intergenic
973365208 4:49203579-49203601 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
973395384 4:49588875-49588897 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
973871282 4:55169466-55169488 GGGAAGAACCTTCCAGAGGAAGG - Intergenic
976342491 4:83960758-83960780 GTGGAGAACCTGAAAGAGCAGGG - Intergenic
977929332 4:102734409-102734431 CTGGAGAACCTGCTATGGTACGG + Intronic
979057734 4:116016802-116016824 CTGGTCAACCTCCCAGAGGAGGG - Intergenic
981074364 4:140576777-140576799 GTGGAGATCATGCCAAAGGATGG - Intergenic
983347581 4:166546443-166546465 CTGGAGCACAGGCCAGAGCAGGG - Intergenic
984884785 4:184440566-184440588 CTGGAGAACCTCGCAGCAGATGG + Intronic
1202762589 4_GL000008v2_random:125206-125228 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
985577095 5:678538-678560 CTGTGGACCCTCCCAGAGGAAGG - Intronic
986663103 5:10076514-10076536 CGGGAGGAGCTCCCAGAGGAGGG - Intergenic
986717288 5:10533459-10533481 GTGGAGACGCTGGCAGAGGAGGG - Intergenic
987656397 5:20813781-20813803 CTGTAGAACATGCCAAAGCATGG + Intergenic
988454397 5:31374233-31374255 CTGGAGAAGCTGGCAGACAATGG + Intergenic
988767160 5:34390165-34390187 CTGTAGAACATGCCAAAGCATGG - Intergenic
990237665 5:53784920-53784942 CTGGAGCATCTACCACAGGATGG - Intergenic
991514626 5:67421075-67421097 CTTGACAACCTGCAAGAGGAGGG - Intergenic
992013712 5:72555977-72555999 CTGGAGACCCTTGCAGAGGGTGG - Intergenic
992383755 5:76264795-76264817 GGGAAGAACCTTCCAGAGGAAGG - Intronic
996007638 5:118442173-118442195 CTGCAGAAGCTGTCATAGGATGG + Intergenic
996468033 5:123825947-123825969 CTAGAGAAGCTGCGAGAAGAGGG + Intergenic
999422471 5:151456882-151456904 CAGCACCACCTGCCAGAGGATGG - Intronic
999550044 5:152676716-152676738 TTGGAGAATATGTCAGAGGAAGG + Intergenic
1001564674 5:172691996-172692018 CTTGAGAACCTGCCTGGGAATGG - Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1003164406 6:3663718-3663740 CTGGAGAGGGTGCCAGAGGCAGG - Intergenic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1005974793 6:30789852-30789874 CTGGGGACCTTGCCAGAGGAAGG - Intergenic
1007268826 6:40620284-40620306 CTGGAGAGCATGCCAGAGCCTGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1011065576 6:83321932-83321954 TGGGGGAAGCTGCCAGAGGAAGG + Intronic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1012050056 6:94329554-94329576 CTGGAAAGCCTTCCCGAGGATGG + Intergenic
1013388310 6:109655132-109655154 GTGGACAACCTGTCAAAGGATGG + Intronic
1015106130 6:129539240-129539262 CTGGGGAAGCTGCCACAGGTGGG - Intergenic
1015506649 6:133995311-133995333 CTGGAGAATGTGCCGGAGAAGGG + Intronic
1019810902 7:3164499-3164521 CCGGAGACCTTTCCAGAGGAAGG + Intronic
1019850040 7:3545663-3545685 ATGCTGAACCAGCCAGAGGATGG - Intronic
1019867677 7:3727952-3727974 TTGGAGAAACTGCCAGAGACTGG - Intronic
1020168050 7:5823473-5823495 CTGCACAAGCTTCCAGAGGACGG - Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1021678780 7:23107762-23107784 CAGGAGAACCTGGCAGATTAAGG - Intronic
1021696537 7:23281775-23281797 CTGAAGGACCTGCCTGAGGCTGG - Intergenic
1022092287 7:27115571-27115593 CGTAAGAACCTGCCAGGGGAAGG + Intronic
1023117762 7:36878985-36879007 CTGTAGAACATCTCAGAGGATGG - Intronic
1023889413 7:44381757-44381779 CTCGTGAACCTGCCTGAGGGTGG + Exonic
1024398219 7:48893563-48893585 CTGCAGATCCTGCCAGGTGATGG + Intergenic
1025182657 7:56831430-56831452 CTGGAGAGACTGTCAGAGGCAGG + Intergenic
1026034786 7:66823201-66823223 CTGGAGAACCTGTGAGCTGATGG + Intergenic
1029153122 7:98495392-98495414 CTGGAGAATATTACAGAGGAAGG + Intergenic
1029283739 7:99452535-99452557 CTGGACAACTTGGGAGAGGAGGG + Intronic
1029594154 7:101528043-101528065 CTGGAGCGCCTGCCCGGGGATGG + Intronic
1030230930 7:107207687-107207709 CTGGAGCACCTGCCTGATGCAGG + Intronic
1031300562 7:120057718-120057740 CTGGTCAGCCTCCCAGAGGAGGG + Intergenic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1033866001 7:145691372-145691394 CTGCAAATCCTGCCAGATGATGG + Intergenic
1035421667 7:158734430-158734452 CTGAAGAACTTGCCAAAGGCTGG - Exonic
1035592290 8:825098-825120 CTGCAGACCCTGCCAGAGGAGGG + Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036676418 8:10837624-10837646 TAGGAGTACCTGCTAGAGGATGG - Intronic
1037496792 8:19448148-19448170 TTGGAGATCTTGCCAGAGTAGGG + Intronic
1037588139 8:20292149-20292171 CTGAGGAATCTTCCAGAGGAAGG + Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1038335173 8:26640290-26640312 ATAGAGAGCCTGCCAGAGGCTGG + Intronic
1039475023 8:37835236-37835258 CTGCACAGCCTTCCAGAGGAGGG + Exonic
1040466248 8:47697906-47697928 CTGCAGAGCCTGCCAGACTAGGG + Intronic
1044108187 8:88238093-88238115 ATGGTGAACCTGTCACAGGAAGG + Intronic
1045034302 8:98165446-98165468 CTGGAACACATGCCAGAGGTCGG + Intergenic
1047294738 8:123560693-123560715 GAGGAGAACCTGCCAGAGAATGG + Intergenic
1048233171 8:132663777-132663799 CTGGAGAAGCTGCCATTGCAAGG - Intronic
1048381614 8:133870444-133870466 GTTGAGAACCTACCAGAGGTGGG - Intergenic
1048938278 8:139375062-139375084 CTAGAGAACATAGCAGAGGAGGG - Intergenic
1049206445 8:141365809-141365831 CTGGAGGGCCTCCCTGAGGAGGG - Intronic
1051893278 9:21965065-21965087 CTGGAGGCCCGGCCAAAGGAAGG + Intronic
1052347823 9:27427856-27427878 CTGGAGAGCCTGACCTAGGAGGG - Intronic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056358291 9:85825082-85825104 CTGGAGATCCTGCCAGAGGAGGG + Intergenic
1056935451 9:90912360-90912382 CTGGACCTCCTGCCAGAGGCCGG + Intergenic
1057139163 9:92716450-92716472 CTGCAGGACGTGCCAGAGCAGGG - Intronic
1057724587 9:97559181-97559203 CTGGAGAGCCTGCCCCAGAATGG + Intronic
1058093199 9:100829128-100829150 GAGGGGAACCTGCCAGATGAGGG + Intergenic
1058717884 9:107738738-107738760 CTGGAGGCCATGACAGAGGAAGG - Intergenic
1062259849 9:135656072-135656094 CTGGGGAACTTGACAGAAGAGGG + Intergenic
1203749270 Un_GL000218v1:63375-63397 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1203543349 Un_KI270743v1:110087-110109 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1185835023 X:3337668-3337690 CTGGAGAACGTGTCAGAGCTGGG + Intronic
1186159979 X:6767289-6767311 GTAAAGCACCTGCCAGAGGAAGG + Intergenic
1187678158 X:21738805-21738827 CTGGAGAACTTGCCTCAGTACGG + Intronic
1189239678 X:39515743-39515765 CTGGAGACCCTCCCCAAGGATGG - Intergenic
1191189787 X:57654766-57654788 CTGCAGATCCTGCCAGGTGATGG + Intergenic
1191966969 X:66769276-66769298 CTGGAGAACAAGCTAGAGAAAGG - Intergenic
1192225792 X:69226908-69226930 CTGGAGGACCTGGCAGGGGAGGG + Intergenic
1193908003 X:87265693-87265715 CTGGACATGCTCCCAGAGGAAGG + Intergenic
1194391870 X:93329003-93329025 CTGGAGAGTCTGCCTGAGAATGG - Intergenic
1194600334 X:95913154-95913176 CTGGAGAACTAACCACAGGAAGG - Intergenic
1194773084 X:97928706-97928728 CTTGAGAACCTGCCATGGGTCGG - Intergenic
1194804240 X:98307504-98307526 CTGGAGAACCTGACCCAAGATGG + Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1196019196 X:110972342-110972364 GGGGAGAAGCTTCCAGAGGAAGG + Intronic
1197122315 X:122906762-122906784 CTGGAGAAGCTTCCAGTGGGAGG + Intergenic
1197760144 X:130022177-130022199 CTGGAGCAGGTCCCAGAGGAGGG - Intronic
1197769607 X:130081859-130081881 CTGGAGAAACTGCCAGATGGAGG + Intronic
1198809708 X:140523103-140523125 CTGGAGAAACCAGCAGAGGATGG + Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1200093888 X:153648281-153648303 CTGCAGAAGCTGCGAGAGGAAGG + Exonic
1200148913 X:153941991-153942013 CTGGAGAATGTGTCAGAGGGTGG - Exonic
1201071402 Y:10150320-10150342 ATGAAGATCCTGCCACAGGATGG - Intergenic
1201162630 Y:11178386-11178408 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1201241585 Y:11962038-11962060 CTGGAGAACTTGTCAGAGCTGGG - Intergenic
1201553687 Y:15246068-15246090 GTAAAGCACCTGCCAGAGGAAGG + Intergenic
1201858609 Y:18571671-18571693 CTGGACAACCTCCAAAAGGAGGG + Intronic
1201874712 Y:18748710-18748732 CTGGACAACCTCCAAAAGGAGGG - Intronic