ID: 1056163551

View in Genome Browser
Species Human (GRCh38)
Location 9:83921275-83921297
Sequence GCGGGAGCGGCGGGCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1684
Summary {0: 2, 1: 13, 2: 25, 3: 229, 4: 1415}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056163529_1056163551 23 Left 1056163529 9:83921229-83921251 CCGACCCCAAGCCGGAGCCTACT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163533_1056163551 12 Left 1056163533 9:83921240-83921262 CCGGAGCCTACTAGTCCCAACGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163536_1056163551 6 Left 1056163536 9:83921246-83921268 CCTACTAGTCCCAACGGCCGGCT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163530_1056163551 19 Left 1056163530 9:83921233-83921255 CCCCAAGCCGGAGCCTACTAGTC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163532_1056163551 17 Left 1056163532 9:83921235-83921257 CCAAGCCGGAGCCTACTAGTCCC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163541_1056163551 -3 Left 1056163541 9:83921255-83921277 CCCAACGGCCGGCTGGGGGCGCG 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163542_1056163551 -4 Left 1056163542 9:83921256-83921278 CCAACGGCCGGCTGGGGGCGCGG 0: 1
1: 0
2: 4
3: 26
4: 216
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163527_1056163551 25 Left 1056163527 9:83921227-83921249 CCCCGACCCCAAGCCGGAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163531_1056163551 18 Left 1056163531 9:83921234-83921256 CCCAAGCCGGAGCCTACTAGTCC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1056163528_1056163551 24 Left 1056163528 9:83921228-83921250 CCCGACCCCAAGCCGGAGCCTAC 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056163551 Original CRISPR GCGGGAGCGGCGGGCGCGGC GGG Intronic